ID: 1097548904

View in Genome Browser
Species Human (GRCh38)
Location 12:61041656-61041678
Sequence CTGTGGAATGGAAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097548904_1097548910 23 Left 1097548904 12:61041656-61041678 CCCTCTACCTTTCCATTCCACAG No data
Right 1097548910 12:61041702-61041724 GTCAATCCTATCTATAGATTTGG No data
1097548904_1097548909 -6 Left 1097548904 12:61041656-61041678 CCCTCTACCTTTCCATTCCACAG No data
Right 1097548909 12:61041673-61041695 CCACAGCACATGTTATTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097548904 Original CRISPR CTGTGGAATGGAAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr