ID: 1097557455

View in Genome Browser
Species Human (GRCh38)
Location 12:61156888-61156910
Sequence ACACCTTTCTTTGCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097557455_1097557459 11 Left 1097557455 12:61156888-61156910 CCTGTTTTAGCAAAGAAAGGTGT No data
Right 1097557459 12:61156922-61156944 AGTAATATCTTTAGGTTTCATGG No data
1097557455_1097557462 30 Left 1097557455 12:61156888-61156910 CCTGTTTTAGCAAAGAAAGGTGT No data
Right 1097557462 12:61156941-61156963 ATGGTTGGCTTTAGGAAAAATGG No data
1097557455_1097557458 3 Left 1097557455 12:61156888-61156910 CCTGTTTTAGCAAAGAAAGGTGT No data
Right 1097557458 12:61156914-61156936 AAAGTTAGAGTAATATCTTTAGG No data
1097557455_1097557461 22 Left 1097557455 12:61156888-61156910 CCTGTTTTAGCAAAGAAAGGTGT No data
Right 1097557461 12:61156933-61156955 TAGGTTTCATGGTTGGCTTTAGG No data
1097557455_1097557460 15 Left 1097557455 12:61156888-61156910 CCTGTTTTAGCAAAGAAAGGTGT No data
Right 1097557460 12:61156926-61156948 ATATCTTTAGGTTTCATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097557455 Original CRISPR ACACCTTTCTTTGCTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr