ID: 1097566570

View in Genome Browser
Species Human (GRCh38)
Location 12:61277430-61277452
Sequence GACCATGTTGATGGTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097566570_1097566574 10 Left 1097566570 12:61277430-61277452 CCAGTATTACCATCAACATGGTC No data
Right 1097566574 12:61277463-61277485 AAAACTATCATGATTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097566570 Original CRISPR GACCATGTTGATGGTAATAC TGG (reversed) Intergenic
No off target data available for this crispr