ID: 1097575520

View in Genome Browser
Species Human (GRCh38)
Location 12:61388510-61388532
Sequence TTTATAATTTACCCAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46291
Summary {0: 61, 1: 6813, 2: 13534, 3: 14365, 4: 11518}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097575520_1097575524 16 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575524 12:61388549-61388571 GACTCACAGTACCACAGGACTGG No data
1097575520_1097575525 17 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575525 12:61388550-61388572 ACTCACAGTACCACAGGACTGGG No data
1097575520_1097575526 18 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575526 12:61388551-61388573 CTCACAGTACCACAGGACTGGGG No data
1097575520_1097575523 11 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575523 12:61388544-61388566 TAATTGACTCACAGTACCACAGG 0: 6
1: 599
2: 1182
3: 1922
4: 2798
1097575520_1097575529 28 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575529 12:61388561-61388583 CACAGGACTGGGGAGGCCTCAGG 0: 11
1: 235
2: 1359
3: 2570
4: 5134
1097575520_1097575527 21 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575527 12:61388554-61388576 ACAGTACCACAGGACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097575520 Original CRISPR TTTATAATTTACCCAGTCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr