ID: 1097575524

View in Genome Browser
Species Human (GRCh38)
Location 12:61388549-61388571
Sequence GACTCACAGTACCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097575520_1097575524 16 Left 1097575520 12:61388510-61388532 CCTGAGACTGGGTAAATTATAAA 0: 61
1: 6813
2: 13534
3: 14365
4: 11518
Right 1097575524 12:61388549-61388571 GACTCACAGTACCACAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097575524 Original CRISPR GACTCACAGTACCACAGGAC TGG Intergenic
No off target data available for this crispr