ID: 1097578455

View in Genome Browser
Species Human (GRCh38)
Location 12:61424009-61424031
Sequence CTGTTTTACCGGAAGTCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097578455_1097578458 -3 Left 1097578455 12:61424009-61424031 CCAGTCGACTTCCGGTAAAACAG No data
Right 1097578458 12:61424029-61424051 CAGATTACCTTCCATAATGTGGG No data
1097578455_1097578459 0 Left 1097578455 12:61424009-61424031 CCAGTCGACTTCCGGTAAAACAG No data
Right 1097578459 12:61424032-61424054 ATTACCTTCCATAATGTGGGTGG No data
1097578455_1097578460 1 Left 1097578455 12:61424009-61424031 CCAGTCGACTTCCGGTAAAACAG No data
Right 1097578460 12:61424033-61424055 TTACCTTCCATAATGTGGGTGGG No data
1097578455_1097578457 -4 Left 1097578455 12:61424009-61424031 CCAGTCGACTTCCGGTAAAACAG No data
Right 1097578457 12:61424028-61424050 ACAGATTACCTTCCATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097578455 Original CRISPR CTGTTTTACCGGAAGTCGAC TGG (reversed) Intergenic
No off target data available for this crispr