ID: 1097582942

View in Genome Browser
Species Human (GRCh38)
Location 12:61480981-61481003
Sequence GACTCAGCTGTTCCAACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097582941_1097582942 -4 Left 1097582941 12:61480962-61480984 CCATCTTTGCTGTTTAGATGACT No data
Right 1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG No data
1097582937_1097582942 30 Left 1097582937 12:61480928-61480950 CCGGGACAAAGTTCCTGGGGGAA No data
Right 1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG No data
1097582940_1097582942 17 Left 1097582940 12:61480941-61480963 CCTGGGGGAAGGAATAGGCTGCC No data
Right 1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097582942 Original CRISPR GACTCAGCTGTTCCAACCTG TGG Intergenic
No off target data available for this crispr