ID: 1097582977

View in Genome Browser
Species Human (GRCh38)
Location 12:61481158-61481180
Sequence TGTTGGCTAGAGAACACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097582977_1097582985 20 Left 1097582977 12:61481158-61481180 CCACCAGTGTTCTCTAGCCAACA No data
Right 1097582985 12:61481201-61481223 GATGGAGCTCCCAAAGAGAGAGG No data
1097582977_1097582982 -2 Left 1097582977 12:61481158-61481180 CCACCAGTGTTCTCTAGCCAACA No data
Right 1097582982 12:61481179-61481201 CAGAGATTTGGAAATTTCCTGGG No data
1097582977_1097582983 2 Left 1097582977 12:61481158-61481180 CCACCAGTGTTCTCTAGCCAACA No data
Right 1097582983 12:61481183-61481205 GATTTGGAAATTTCCTGGGATGG No data
1097582977_1097582981 -3 Left 1097582977 12:61481158-61481180 CCACCAGTGTTCTCTAGCCAACA No data
Right 1097582981 12:61481178-61481200 ACAGAGATTTGGAAATTTCCTGG No data
1097582977_1097582986 24 Left 1097582977 12:61481158-61481180 CCACCAGTGTTCTCTAGCCAACA No data
Right 1097582986 12:61481205-61481227 GAGCTCCCAAAGAGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097582977 Original CRISPR TGTTGGCTAGAGAACACTGG TGG (reversed) Intergenic
No off target data available for this crispr