ID: 1097585021

View in Genome Browser
Species Human (GRCh38)
Location 12:61504933-61504955
Sequence CCTTTTCTGTAGTGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097585021_1097585025 -1 Left 1097585021 12:61504933-61504955 CCTGCTTCCCACTACAGAAAAGG No data
Right 1097585025 12:61504955-61504977 GATTGACAAATGACACACAGAGG No data
1097585021_1097585026 4 Left 1097585021 12:61504933-61504955 CCTGCTTCCCACTACAGAAAAGG No data
Right 1097585026 12:61504960-61504982 ACAAATGACACACAGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097585021 Original CRISPR CCTTTTCTGTAGTGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr