ID: 1097589124

View in Genome Browser
Species Human (GRCh38)
Location 12:61552103-61552125
Sequence GTGGTCCATGGACTGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097589124_1097589130 -2 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589130 12:61552124-61552146 ACAACCAGACTCATGGTCCAGGG No data
1097589124_1097589132 6 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589132 12:61552132-61552154 ACTCATGGTCCAGGGAAGTTAGG No data
1097589124_1097589127 -9 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589127 12:61552117-61552139 ATGGACCACAACCAGACTCATGG No data
1097589124_1097589135 26 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589124_1097589129 -3 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589129 12:61552123-61552145 CACAACCAGACTCATGGTCCAGG No data
1097589124_1097589134 15 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589134 12:61552141-61552163 CCAGGGAAGTTAGGAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097589124 Original CRISPR GTGGTCCATGGACTGGACTG TGG (reversed) Intergenic
No off target data available for this crispr