ID: 1097589126

View in Genome Browser
Species Human (GRCh38)
Location 12:61552115-61552137
Sequence ATGAGTCTGGTTGTGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097589126_1097589132 -6 Left 1097589126 12:61552115-61552137 CCATGGACCACAACCAGACTCAT No data
Right 1097589132 12:61552132-61552154 ACTCATGGTCCAGGGAAGTTAGG No data
1097589126_1097589134 3 Left 1097589126 12:61552115-61552137 CCATGGACCACAACCAGACTCAT No data
Right 1097589134 12:61552141-61552163 CCAGGGAAGTTAGGAATCTTAGG No data
1097589126_1097589135 14 Left 1097589126 12:61552115-61552137 CCATGGACCACAACCAGACTCAT No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097589126 Original CRISPR ATGAGTCTGGTTGTGGTCCA TGG (reversed) Intergenic
No off target data available for this crispr