ID: 1097589131

View in Genome Browser
Species Human (GRCh38)
Location 12:61552128-61552150
Sequence ACTTCCCTGGACCATGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097589131_1097589135 1 Left 1097589131 12:61552128-61552150 CCAGACTCATGGTCCAGGGAAGT No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589131_1097589134 -10 Left 1097589131 12:61552128-61552150 CCAGACTCATGGTCCAGGGAAGT No data
Right 1097589134 12:61552141-61552163 CCAGGGAAGTTAGGAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097589131 Original CRISPR ACTTCCCTGGACCATGAGTC TGG (reversed) Intergenic