ID: 1097589135

View in Genome Browser
Species Human (GRCh38)
Location 12:61552152-61552174
Sequence AGGAATCTTAGGAGCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097589128_1097589135 7 Left 1097589128 12:61552122-61552144 CCACAACCAGACTCATGGTCCAG No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589123_1097589135 27 Left 1097589123 12:61552102-61552124 CCCACAGTCCAGTCCATGGACCA No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589126_1097589135 14 Left 1097589126 12:61552115-61552137 CCATGGACCACAACCAGACTCAT No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589124_1097589135 26 Left 1097589124 12:61552103-61552125 CCACAGTCCAGTCCATGGACCAC No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589125_1097589135 19 Left 1097589125 12:61552110-61552132 CCAGTCCATGGACCACAACCAGA No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data
1097589131_1097589135 1 Left 1097589131 12:61552128-61552150 CCAGACTCATGGTCCAGGGAAGT No data
Right 1097589135 12:61552152-61552174 AGGAATCTTAGGAGCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097589135 Original CRISPR AGGAATCTTAGGAGCACACT TGG Intergenic
No off target data available for this crispr