ID: 1097589553

View in Genome Browser
Species Human (GRCh38)
Location 12:61557443-61557465
Sequence TCTACCCCACAGAATTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097589550_1097589553 0 Left 1097589550 12:61557420-61557442 CCCGGTGAGACCTGTGTTGTACT No data
Right 1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG No data
1097589548_1097589553 23 Left 1097589548 12:61557397-61557419 CCTTGCTGACACATTGATTTCAG No data
Right 1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG No data
1097589551_1097589553 -1 Left 1097589551 12:61557421-61557443 CCGGTGAGACCTGTGTTGTACTT No data
Right 1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG No data
1097589552_1097589553 -10 Left 1097589552 12:61557430-61557452 CCTGTGTTGTACTTCTACCCCAC No data
Right 1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097589553 Original CRISPR TCTACCCCACAGAATTATTT AGG Intergenic
No off target data available for this crispr