ID: 1097590894

View in Genome Browser
Species Human (GRCh38)
Location 12:61573940-61573962
Sequence ACTCACATGGAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097590894_1097590899 -9 Left 1097590894 12:61573940-61573962 CCTTCCACCTCCTCCATGTGAGT No data
Right 1097590899 12:61573954-61573976 CATGTGAGTATACAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097590894 Original CRISPR ACTCACATGGAGGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr