ID: 1097595637

View in Genome Browser
Species Human (GRCh38)
Location 12:61626065-61626087
Sequence TTTTTATCTGGGCTCTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097595637_1097595641 9 Left 1097595637 12:61626065-61626087 CCCAGCAAGAGCCCAGATAAAAA No data
Right 1097595641 12:61626097-61626119 TTAAACAAAAAGAATAAAGCTGG No data
1097595637_1097595642 12 Left 1097595637 12:61626065-61626087 CCCAGCAAGAGCCCAGATAAAAA No data
Right 1097595642 12:61626100-61626122 AACAAAAAGAATAAAGCTGGAGG 0: 15
1: 533
2: 5698
3: 16832
4: 9937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097595637 Original CRISPR TTTTTATCTGGGCTCTTGCT GGG (reversed) Intergenic
No off target data available for this crispr