ID: 1097600258

View in Genome Browser
Species Human (GRCh38)
Location 12:61682869-61682891
Sequence ACTAATATTCAGACTCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097600258_1097600262 24 Left 1097600258 12:61682869-61682891 CCTTCTAGAGTCTGAATATTAGT No data
Right 1097600262 12:61682916-61682938 AATATTTTTTCCCATTCTGTGGG 0: 105
1: 2914
2: 14543
3: 18025
4: 10344
1097600258_1097600261 23 Left 1097600258 12:61682869-61682891 CCTTCTAGAGTCTGAATATTAGT No data
Right 1097600261 12:61682915-61682937 AAATATTTTTTCCCATTCTGTGG 0: 52
1: 1293
2: 2637
3: 3724
4: 5163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097600258 Original CRISPR ACTAATATTCAGACTCTAGA AGG (reversed) Intergenic
No off target data available for this crispr