ID: 1097601874

View in Genome Browser
Species Human (GRCh38)
Location 12:61703154-61703176
Sequence ACCACAGATACCAATAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097601872_1097601874 -1 Left 1097601872 12:61703132-61703154 CCTCAGCAGAACTGCCTGCAAAA No data
Right 1097601874 12:61703154-61703176 ACCACAGATACCAATAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097601874 Original CRISPR ACCACAGATACCAATAGATA TGG Intergenic
No off target data available for this crispr