ID: 1097604522

View in Genome Browser
Species Human (GRCh38)
Location 12:61736088-61736110
Sequence AAGCCAGGGATTGCTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097604522_1097604528 -2 Left 1097604522 12:61736088-61736110 CCCTTCTCAGCAATCCCTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1097604528 12:61736109-61736131 TTACTATGGCAGAGTCTGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 116
1097604522_1097604529 8 Left 1097604522 12:61736088-61736110 CCCTTCTCAGCAATCCCTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1097604529 12:61736119-61736141 AGAGTCTGCTGGGTTCTGCAAGG 0: 1
1: 0
2: 3
3: 17
4: 241
1097604522_1097604527 -3 Left 1097604522 12:61736088-61736110 CCCTTCTCAGCAATCCCTGGCTT 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1097604527 12:61736108-61736130 CTTACTATGGCAGAGTCTGCTGG 0: 1
1: 0
2: 2
3: 17
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097604522 Original CRISPR AAGCCAGGGATTGCTGAGAA GGG (reversed) Intronic
900092860 1:927980-928002 AGGCCAGGGCTGGCTGGGAATGG - Intronic
900393310 1:2443215-2443237 GTGCCTGGGACTGCTGAGAACGG - Intronic
901128961 1:6950213-6950235 AAGCAAGGGCGTGTTGAGAAGGG - Intronic
901428255 1:9197315-9197337 AGGCCGGGGACTGCAGAGAAAGG - Intergenic
902875237 1:19337056-19337078 TAGCAAGGGATTGCTGAAACTGG - Intergenic
902876804 1:19345285-19345307 AAGCCAGAGATTTCTGAGAACGG + Intronic
904488721 1:30844812-30844834 AAGCCAGGCTTTGTTGAGAGAGG - Intergenic
905732562 1:40306659-40306681 AAGCCAAGGCCTGTTGAGAAGGG + Intronic
906041034 1:42787948-42787970 AAGCCAGGGAAATCTGGGAAGGG - Intronic
906283445 1:44569703-44569725 AAGCCAGGGTCTGGTGGGAAGGG + Intronic
906661990 1:47589584-47589606 AATCCAGAGAATGCAGAGAAGGG - Intergenic
910136947 1:83983534-83983556 AAGCCAGTGTTTGCTAGGAAGGG - Intronic
910645283 1:89507769-89507791 ATGCCAGGGATTGCAGAGATAGG - Intergenic
913401016 1:118433053-118433075 AAGGCAGAGATTGCTGAGTAGGG + Intergenic
914331340 1:146673418-146673440 AATCCAGGTGTTGCTGTGAAGGG - Intergenic
914422416 1:147541578-147541600 AGGCCAGGGATTGCGGGAAAAGG + Exonic
914876473 1:151516162-151516184 AAGCCAGGGTGAGATGAGAAGGG - Intronic
915054412 1:153112876-153112898 AAGCCAGGGACTCTTGAAAAGGG - Intronic
915909853 1:159908215-159908237 GAGCCAAGTTTTGCTGAGAAGGG - Intergenic
916324164 1:163538496-163538518 AAGCCATAAATTTCTGAGAAAGG - Intergenic
916996122 1:170302809-170302831 AATCCAGTGACTGGTGAGAAGGG + Intergenic
917716198 1:177740469-177740491 AGGACAGAGATTTCTGAGAATGG - Intergenic
917731671 1:177881047-177881069 AAGCCAGGGACAGATGGGAAAGG - Intergenic
919132554 1:193469496-193469518 AAGCCAGGGCTTTCTGAGCAAGG - Intergenic
922499091 1:226083660-226083682 CAGCCAGGGCTGGCGGAGAAGGG - Intergenic
1062779081 10:184981-185003 AAGCCCGGTATTACAGAGAAAGG - Intronic
1063276921 10:4579522-4579544 AAACCATTGATTGCAGAGAAAGG + Intergenic
1064899345 10:20276763-20276785 CAGCCAGGGATTTCAGAGAAGGG - Intronic
1067794212 10:49308949-49308971 AGGCCTGGGAGTGCTGAGCAGGG - Intronic
1068931019 10:62590272-62590294 GAGGCAGGGGTTACTGAGAAGGG + Intronic
1070103094 10:73406939-73406961 AAGCAAAGGAATGCTGGGAATGG - Intronic
1070150537 10:73802309-73802331 AGGCCTGAGATGGCTGAGAAGGG - Exonic
1070562141 10:77576016-77576038 CAGCCATGGATTGGGGAGAATGG + Intronic
1070720417 10:78753046-78753068 CAGCCAAGGAGTGCTGAGCATGG - Intergenic
1070779666 10:79130187-79130209 AAGCCAGGGAGGGCTGGAAAGGG - Intronic
1071376609 10:85012135-85012157 TTGCCAGAGATTTCTGAGAATGG - Intergenic
1071827546 10:89340207-89340229 CAACCTGGGATTGCTGAGCAGGG + Exonic
1072227456 10:93383804-93383826 AAGCCAGGGACTGCACAGGATGG + Intronic
1074184459 10:111088522-111088544 ATGGCTGGTATTGCTGAGAAGGG + Intergenic
1074393940 10:113081463-113081485 TAGCCAGTCATTGCTGAGTAAGG + Intronic
1075279536 10:121127884-121127906 GACCCATGGATTGCTGTGAAGGG - Intergenic
1075613242 10:123870591-123870613 AAGCCAGTGGTATCTGAGAAAGG - Intronic
1075870731 10:125771341-125771363 AAGACACAGAGTGCTGAGAATGG + Intronic
1080057803 11:27925438-27925460 AAGCCGAGGAATGCTCAGAAGGG - Intergenic
1081595718 11:44458081-44458103 AAGGCAGGAATTGCAGAGATTGG + Intergenic
1081760393 11:45572706-45572728 ATCCCAGGGAGTGCTGGGAAAGG - Intergenic
1081839096 11:46182930-46182952 AATCCAGAGACAGCTGAGAATGG + Intergenic
1083270238 11:61568580-61568602 CAGCCAGCGAGTGCTGAGACGGG + Intronic
1083526486 11:63370993-63371015 AGGTCAGGTAATGCTGAGAAAGG + Intronic
1084478531 11:69402578-69402600 AAGCCAGGCATGGCGGAGGATGG + Intergenic
1084937631 11:72595533-72595555 GAGTCAGGGATGGCTGAGAGGGG - Intronic
1085723221 11:78931551-78931573 AAGCCAGTGGATGCTGATAAAGG - Intronic
1086239317 11:84670186-84670208 AAGACAGGGAAGGCTCAGAATGG - Intronic
1086932141 11:92705118-92705140 AACACTGGGATTTCTGAGAAAGG - Intronic
1087767334 11:102170053-102170075 AACCCAGTGATGGCTGATAAAGG + Intronic
1088781236 11:113136186-113136208 AAGAATGGGACTGCTGAGAAAGG + Intronic
1090426221 11:126608655-126608677 TAGCCAGGGAGGGCTGGGAAGGG - Intronic
1090944851 11:131420648-131420670 GAGCCAGGGATGCATGAGAATGG - Intronic
1091155919 11:133372825-133372847 AAGCAAGAGATACCTGAGAATGG - Intronic
1092816939 12:12320608-12320630 AAGGCAGGGGCTGCTGGGAAAGG + Intergenic
1093192393 12:16090546-16090568 AAGCCATGAATTGCTGAAATAGG - Intergenic
1093591642 12:20908542-20908564 GATCCAGGGATTACTGGGAAAGG - Intronic
1095391647 12:41714358-41714380 AAGCAAGGGATAGCAGAAAATGG - Intergenic
1096322427 12:50627099-50627121 AAGCCAGCTTTTGCTGAGCAAGG + Intronic
1096589261 12:52646644-52646666 AAGACAGGGAAAGCAGAGAATGG - Intronic
1097604522 12:61736088-61736110 AAGCCAGGGATTGCTGAGAAGGG - Intronic
1098567073 12:71948676-71948698 AAGCAATGGCTTGCTAAGAATGG - Intronic
1100200786 12:92295914-92295936 AAGCCAGTGAATGAGGAGAAAGG + Intergenic
1100270936 12:93023803-93023825 AAGCCAAAGAGTGGTGAGAATGG - Intergenic
1100756122 12:97752730-97752752 TAGCCAGGTATTGTTCAGAATGG + Intergenic
1100862775 12:98824188-98824210 AAGCCAGGGAAAGCAGAGAATGG - Intronic
1101123589 12:101608717-101608739 AAGCGGGGGATTCCTTAGAAAGG + Intronic
1101823350 12:108201261-108201283 AAGCAAGGGATTGCTGAGGATGG - Intronic
1102882132 12:116493709-116493731 CAGCCAGGTCTTGCTGAGAGTGG - Intergenic
1102901373 12:116640319-116640341 AATCTAGGCATTGCTGTGAAGGG + Intergenic
1102951394 12:117033767-117033789 AAGCCAGGAAGAGCTGAGTAGGG - Intergenic
1103707649 12:122887295-122887317 AAGCCAGGGAGTGCTGCGGTTGG - Intronic
1106000370 13:25717339-25717361 TAGCCATTGAGTGCTGAGAATGG + Intronic
1107017204 13:35717053-35717075 AATCCAGGAATTGCTGGGAAAGG - Intergenic
1107061649 13:36166029-36166051 AAGAAAGGGTTTGCTGAGATGGG - Intergenic
1109789243 13:67226357-67226379 GAGCCAGGAATGGCTGAGAGGGG + Exonic
1110317604 13:74129366-74129388 ATGCCAGGAATTACTGTGAAAGG + Intronic
1114862022 14:26535547-26535569 ATGCCAGGGTTTTTTGAGAAAGG - Intronic
1115350069 14:32384458-32384480 AAGCAAAGGATAGCTGATAATGG + Intronic
1118061628 14:62144938-62144960 GAGCCAGGCATTGGAGAGAAAGG - Intergenic
1118439343 14:65798719-65798741 AAGTCGGGGGTAGCTGAGAAGGG + Intergenic
1120320139 14:82949256-82949278 AAGCCATTGATTGCTGAAAAGGG + Intergenic
1121020054 14:90574395-90574417 GAGGCAGAGATTGCTGAGGATGG - Intronic
1121116532 14:91347077-91347099 AAGCCAGTGACGGCTGGGAAGGG - Intronic
1121996564 14:98607623-98607645 AAAGCAGGGAGTGCTGAGCAGGG - Intergenic
1122493111 14:102133448-102133470 TACCCAGGGCTTGGTGAGAATGG + Intronic
1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG + Intronic
1123958373 15:25365434-25365456 ATGCCTGGGATTTCTAAGAAAGG + Intronic
1124411532 15:29441447-29441469 ATGCCATGGAGTTCTGAGAATGG - Intronic
1126417043 15:48428429-48428451 AAGCCAGGGATCTGTGAGAATGG - Exonic
1126497988 15:49313516-49313538 AAGACAGGGCTTGCTGGGGAAGG - Intronic
1127225835 15:56927792-56927814 AGGCCAGGGATTGATGTTAATGG + Intronic
1128810879 15:70571692-70571714 ATGTCAGGGCTTGCGGAGAAAGG + Intergenic
1130103488 15:80911943-80911965 GAGGCTGGGATTGCTGGGAAAGG + Intronic
1131021831 15:89105715-89105737 AAGCCAGGGACTGCCCTGAAAGG - Intronic
1131199595 15:90385832-90385854 AGGCCAGGCATTCTTGAGAAAGG - Intergenic
1134430293 16:14197994-14198016 TTGCCAGGGATTGCGGGGAAGGG - Intronic
1134900156 16:17930905-17930927 AAGCTAGGGCTTCCTGAGAATGG + Intergenic
1137376616 16:47957193-47957215 AAGCCAGGCAATTCTGAGGATGG - Intergenic
1137584254 16:49654531-49654553 AAGCCCGGGAGGGCTGGGAATGG + Intronic
1138729234 16:59176437-59176459 AAGCCAGTGATTGGAGAGAAAGG - Intergenic
1140002216 16:71037483-71037505 AATCCAGGTGTTGCTGTGAAGGG + Intronic
1140416459 16:74777116-74777138 GGGCCAGGGATTCCTGAGACAGG + Intergenic
1141635151 16:85310630-85310652 CAGCCTGGGATGGCTGAGAGAGG - Intergenic
1143929892 17:10411410-10411432 ATGCCTGGGATTCATGAGAAAGG - Intronic
1144817266 17:18044046-18044068 AGGCCAGGAAATGCTGAGGATGG - Intronic
1148208981 17:45796808-45796830 AAGCCAGGGAAGACTGAGAAAGG + Intronic
1148692498 17:49538850-49538872 AATCCTGTGAATGCTGAGAAAGG - Intergenic
1148853008 17:50563772-50563794 AAGCCTGGGTTGGCTGAGGATGG + Intronic
1149024546 17:52011260-52011282 AAGCCCAGGATTGCTGACTATGG - Intronic
1150667829 17:67160474-67160496 ATGCTAGGGATTACTGAGTAGGG - Intronic
1151909348 17:77071560-77071582 AAGCGAGGAATGCCTGAGAAGGG - Intergenic
1152162885 17:78680169-78680191 AAGTAAGTGACTGCTGAGAAAGG - Exonic
1152507114 17:80757107-80757129 AAGCCAGGAGATGCAGAGAAGGG + Intronic
1153944513 18:10007343-10007365 ATGCCAGGGAAAGCTGTGAAGGG - Intergenic
1155625243 18:27826994-27827016 AAGCAAGACCTTGCTGAGAAGGG - Intergenic
1156687850 18:39671530-39671552 TAGCCTGGGATTTCTAAGAAAGG + Intergenic
1159708636 18:71725483-71725505 AAGACAGTGATTCCTGAGAAGGG + Intergenic
1159782493 18:72676044-72676066 AAGCCAGGTACTGTTGTGAAGGG - Intergenic
1160106600 18:75983808-75983830 AAGACAGGGATCACTGAGAAGGG - Intergenic
1160761904 19:789687-789709 AAGCCAGGGGTTGCCGACGATGG - Intergenic
1163118765 19:15203213-15203235 AAGGCAGGTATGGCTGAGCATGG + Intergenic
1163237610 19:16038541-16038563 AAGCCAGGGGTGGCTGCAAAAGG - Intergenic
1165899431 19:39161914-39161936 CAGGCAGGCCTTGCTGAGAAGGG - Intronic
1166019365 19:40011783-40011805 AAGCCAAGGAATGCCAAGAATGG - Intronic
1166700085 19:44877385-44877407 AAGCCATGAAGTGCTGAGGAGGG - Intronic
1166998760 19:46732683-46732705 AAGCCAGAGATTCCTGAGGGTGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168405481 19:56108250-56108272 GAGCCAGGGAGTGCTGGGCAGGG - Intronic
1168405522 19:56108354-56108376 GAGCCAGGGAGTGCTGGGCAGGG - Intronic
925352023 2:3208006-3208028 TAGCCAGGGATTTCAGACAATGG - Intronic
925417812 2:3684237-3684259 AAGACAGAGAGTGCTGGGAAAGG - Intronic
925979721 2:9166942-9166964 AAGCCAGGGAATGCTGAGCCTGG + Intergenic
926797194 2:16628765-16628787 AAGCAAGGCATTGCCCAGAAGGG - Intronic
928033077 2:27797900-27797922 AAGCCAGGGGCTGCTCAGAGAGG + Intronic
928180836 2:29067187-29067209 AAGCCAGAGGCTGCTCAGAACGG - Intronic
928406641 2:31020054-31020076 AAGCCAGGGTGTGCTGGGGAAGG - Intronic
928601604 2:32908986-32909008 AAGCCAGGCATTGCAGGGCAAGG + Intergenic
928912993 2:36441557-36441579 AGGCCAGGGGTGGCTGAGGAGGG - Intronic
929119442 2:38472222-38472244 AAAATAGGGATTGCTGAGGATGG + Intergenic
932671913 2:73744948-73744970 AAGTCTGGGGTTGGTGAGAATGG + Intergenic
933793983 2:85905660-85905682 AAAACAGGAATTGCTCAGAAAGG - Intergenic
936933540 2:117815062-117815084 AAGACACTGATTGCTCAGAAAGG - Intronic
937208132 2:120249900-120249922 AAGCTTGGTACTGCTGAGAATGG - Intronic
937871496 2:126789352-126789374 AAGCCAAGGAGTGCTGTGAGGGG - Intergenic
939786119 2:146515377-146515399 AAGTTAAGAATTGCTGAGAAGGG - Intergenic
941653110 2:168114800-168114822 AAGCCAGGGGATGATGAAAACGG + Intronic
941724428 2:168845626-168845648 AACACTGGGAATGCTGAGAAGGG - Intronic
942115531 2:172725746-172725768 AGGACAGGGAGTGCTGACAAGGG - Intergenic
942182083 2:173389806-173389828 AAGCCAGGGAGTGCTGGGGAGGG + Intergenic
942312779 2:174670805-174670827 ATGGCAGCGATTGCTGAGAGTGG - Intronic
942337311 2:174903051-174903073 AAGCAAGGGATTTCTGTGAGAGG - Intronic
942492422 2:176502940-176502962 AAGCCAGGGCTCACTGATAAGGG + Intergenic
944177694 2:196851199-196851221 GAGCCAGGGAAGGCTGTGAAGGG + Intronic
945242862 2:207692410-207692432 CTGCCAGGGCTTGCTGTGAATGG - Intergenic
945540326 2:211078232-211078254 AAGCCTGGGAATACTGAAAATGG + Intergenic
945802199 2:214447876-214447898 AAGACAGTGACTGCTGGGAAAGG - Intronic
1169281618 20:4272534-4272556 AAGCAAGTGAAGGCTGAGAAAGG - Intergenic
1170066695 20:12318237-12318259 AAGCCAGGGATTATTCTGAAGGG - Intergenic
1170775921 20:19374594-19374616 AAGTCAGGTAATGCTGTGAAAGG - Intronic
1170937465 20:20822590-20822612 AAGCCAGGCATGGCTGAGGTGGG + Intergenic
1172426705 20:34860402-34860424 AAGCCAGGGATGGCTGGCACAGG + Intronic
1172491499 20:35342178-35342200 ATGCCAGGGACCGCTGATAAGGG + Intronic
1172793315 20:37520932-37520954 AGGCCAGGGACTGGGGAGAAGGG + Intronic
1172796397 20:37542087-37542109 GGGTCAGGGATTGCTGGGAAGGG + Intergenic
1173161787 20:40658324-40658346 ATCCCAGCAATTGCTGAGAATGG + Intergenic
1173760943 20:45559986-45560008 AAGCTAGGCAATGCTGTGAAGGG + Intronic
1176669875 21:9723199-9723221 AACCCAGTAATGGCTGAGAAAGG + Intergenic
1177320614 21:19514854-19514876 AATCCAGGAAATGCAGAGAATGG + Intergenic
1177943391 21:27438729-27438751 CATCCATGGATTGATGAGAAGGG - Intergenic
1178199598 21:30389122-30389144 AAGCGAGGCAGTGCTGAAAAGGG + Intronic
1178797816 21:35761649-35761671 AAGCCAGTGAAAGTTGAGAATGG - Intronic
1179072861 21:38089277-38089299 AATCCAGGTAATGCTGTGAAGGG + Intronic
1179245501 21:39630712-39630734 AAAGCTGGGATTGCTGAGAGTGG + Intronic
1180557624 22:16590841-16590863 AAAACAGGGATTGCCAAGAAGGG - Exonic
1181359501 22:22323667-22323689 AAGCCAGGGGAGGCTGGGAAAGG - Intergenic
1182141210 22:27960113-27960135 AAGGCAGTGATTCCTGAGAGAGG + Intergenic
1182753133 22:32657630-32657652 AAGGCAGGGCTTGGTAAGAAGGG + Intronic
1183854106 22:40618048-40618070 ATGCCAGGGATTGAGGAGTAAGG + Intronic
1185177808 22:49339801-49339823 AAGACAGTGATTCCTGAGCAGGG - Intergenic
1185234192 22:49702241-49702263 GATCCAGAGACTGCTGAGAAGGG + Intergenic
1185308335 22:50136517-50136539 AGGACAGGGATTCCTGAGAGAGG + Intronic
949681286 3:6517327-6517349 ATGCCAGGGATGACAGAGAAAGG + Intergenic
950418749 3:12884279-12884301 AAGGCAGGGAATGCTCAGCATGG - Intergenic
950482855 3:13255270-13255292 CAGCCAGGGGTTCCTGAGGACGG + Intergenic
951047623 3:18058477-18058499 ATGTCAGGCATTGCTGATAATGG - Intronic
951547376 3:23840877-23840899 AAGGCAGTGATCTCTGAGAAAGG - Intronic
951718507 3:25674040-25674062 AGGCCAGGGGTTGCTGAGGGTGG - Intergenic
952062477 3:29526925-29526947 AAGCCAGGCAAAGCAGAGAATGG - Intronic
952838498 3:37624948-37624970 AAGCTAGGGAGAGCTGGGAAGGG - Intronic
953009459 3:39010867-39010889 AAGGGTGGGATTGCTGAGGAGGG + Intergenic
953028894 3:39163334-39163356 AAGCCAAGGAGTGCCGAGGAGGG - Intergenic
953062058 3:39435407-39435429 GTGGCAGGGATTTCTGAGAAGGG + Intergenic
953607548 3:44421473-44421495 GTGACAGGGATTGCTGAGAACGG + Intergenic
953775545 3:45813504-45813526 AAGCCAAGGAATGGCGAGAACGG + Intergenic
958994074 3:100881201-100881223 GAGACAAGGATTGCTAAGAATGG + Intronic
960401343 3:117203109-117203131 AAGAAAGGTATTTCTGAGAAGGG - Intergenic
962883234 3:139598904-139598926 AAGCCAGGCAGGGCTAAGAAGGG + Intronic
963010344 3:140763466-140763488 AATCTAGGGACTGCTGGGAAGGG + Intergenic
966969512 3:185030357-185030379 AAACCAGGGGTTGCTCAGAGAGG - Intronic
968076847 3:195820660-195820682 CAGCCCGGGAATGCGGAGAATGG - Intergenic
968618311 4:1592430-1592452 AAGCCCAGGATTCCTGAGCAAGG + Intergenic
976269317 4:83215038-83215060 AAGACAGTGATTTCTGAGGAAGG + Intergenic
977413035 4:96691995-96692017 AAGCCAGGGATTTAATAGAATGG + Intergenic
980083377 4:128367569-128367591 AAGCCACAGATTCCTGAGGAAGG + Intergenic
980499030 4:133624953-133624975 AGGCCAGGGCTTGCTGAGCATGG + Intergenic
981569901 4:146140493-146140515 AAGCCAGGGTTTTCTTAGAAAGG - Intergenic
982377391 4:154708272-154708294 GAGTCAGGAATTCCTGAGAAAGG + Intronic
985404906 4:189628331-189628353 AACCCAGTGATGGCTGAGAAAGG - Intergenic
986282973 5:6338699-6338721 AAGCTTGCGATTGCTGAGCATGG - Intergenic
988429897 5:31107358-31107380 AAACAAGAGATTCCTGAGAAGGG - Intergenic
990045098 5:51419657-51419679 AAGCCATGTATGGCTGAGATGGG + Intergenic
992594759 5:78334879-78334901 AAGGCAGGGAGTGATGAGAAGGG + Intergenic
993585068 5:89714348-89714370 AAGCCAAGGAATGCAAAGAAAGG + Intergenic
994632591 5:102304703-102304725 CAGTCAAGGAGTGCTGAGAAAGG - Intergenic
995086550 5:108117746-108117768 AGGCCAGGGATTTCCGAGAGGGG - Intronic
995232269 5:109780784-109780806 AATCCAAGGAGTGCTAAGAATGG - Intronic
995980922 5:118103264-118103286 AAGCCATGGTTTGCTGAGAGAGG - Intergenic
996597811 5:125225817-125225839 AAGCCAAGTGTAGCTGAGAAGGG + Intergenic
1001300707 5:170531732-170531754 AGCCCAGGGAGTGCTGACAATGG + Intronic
1001334610 5:170787312-170787334 AACCCAGGGCTGCCTGAGAATGG + Intronic
1003334631 6:5159058-5159080 AAGCCATGGATTTCGGGGAAAGG + Intronic
1004585604 6:16996757-16996779 GAGCCAAAGATTGCTGACAAGGG + Intergenic
1005717078 6:28559603-28559625 AAGACAAGGATTTCTGAGAAGGG + Intergenic
1006459674 6:34151069-34151091 AAGGCAGGGATGGCTGAGGCTGG + Intronic
1007048644 6:38803045-38803067 AAGCTAGAGATAGCTGAAAATGG - Intronic
1007065596 6:38987562-38987584 AAGGCACTAATTGCTGAGAATGG - Intronic
1007107593 6:39294417-39294439 AAGCCAGGGCCTGCAGAGAGAGG + Intergenic
1007176667 6:39902067-39902089 GAGACAGGGACTGGTGAGAATGG + Exonic
1007210837 6:40192296-40192318 AAGCCTAGAAGTGCTGAGAAAGG + Intergenic
1007428204 6:41760627-41760649 GAGCCAGAGATTGCAGAGCAGGG - Intergenic
1008151573 6:47958434-47958456 AAGACAGTGATCCCTGAGAACGG + Intronic
1011553849 6:88554623-88554645 GAGCCAGGGAATGATGAGAGAGG - Intergenic
1013789619 6:113822241-113822263 AGGCAAGAGATTCCTGAGAATGG + Intergenic
1013970207 6:116008783-116008805 TAGACAGAGAGTGCTGAGAAGGG + Intronic
1014831076 6:126103661-126103683 CAGCCAATAATTGCTGAGAAAGG - Intergenic
1015739367 6:136437116-136437138 ATACCAGGGAGTGCTGAGAAGGG - Intronic
1016173744 6:141052323-141052345 AAGACAGGGAAAGGTGAGAAGGG + Intergenic
1018594578 6:165464651-165464673 AGGACAGGGATTGATTAGAAAGG - Intronic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1019466771 7:1193969-1193991 AAGCCAGGGTGTCCTGAGAGAGG - Intergenic
1020419492 7:7985319-7985341 TATCCAGTGATTGCTGAAAAAGG - Intronic
1021404921 7:20254138-20254160 GAAACAGGGATTGATGAGAAGGG - Intergenic
1021606077 7:22410899-22410921 AAGGCAGGGAGTGCAGAGAAGGG + Intergenic
1021716769 7:23468993-23469015 AAGACAGGGAGTGGCGAGAAAGG + Intronic
1023380599 7:39603569-39603591 AAACCAGAGATTGCTGACCATGG + Intronic
1023645991 7:42315594-42315616 AAACCAGAGATCGCTAAGAAAGG - Intergenic
1026849834 7:73717716-73717738 AAGCCAGGCTTTGCTTTGAATGG - Intronic
1029135040 7:98364212-98364234 CAGCCAGGCTTTACTGAGAAAGG - Intronic
1029177268 7:98673794-98673816 ATGCCAAGGATGGCAGAGAAAGG - Intergenic
1029556778 7:101275862-101275884 GAGCCACGGGTTTCTGAGAAGGG + Intergenic
1029622084 7:101696568-101696590 GAGCCAGGGACAGCTGTGAAGGG + Intergenic
1033132080 7:138753301-138753323 AAGCCAAGGAATGCGGAGGACGG + Intronic
1033149614 7:138902037-138902059 AAGCCAGGGATTGTTGAATAAGG + Intronic
1034297817 7:149989975-149989997 AAGCAGGGGAGTGCAGAGAATGG - Intergenic
1034619695 7:152447164-152447186 AAAACAGGGATTGCCAAGAAGGG + Intergenic
1034677841 7:152904264-152904286 GAGCCAGGCACTGCTGAGCATGG - Intergenic
1034808205 7:154106878-154106900 AAGCAGGGGAGTGCAGAGAATGG + Intronic
1036824390 8:11965078-11965100 GAGCCAGGGAAGGTTGAGAAGGG - Intergenic
1037887137 8:22601096-22601118 AGTCCAGGGAGTCCTGAGAAAGG - Exonic
1038497286 8:28012676-28012698 AAAGCAGGGATTGATGACAATGG - Intergenic
1038902863 8:31863684-31863706 AAGGCAGGACTTTCTGAGAACGG - Intronic
1040322625 8:46326346-46326368 ACACCAGGGATTTCTGGGAAGGG + Intergenic
1045409559 8:101903653-101903675 AAGCCTGGGAAGGCTGAGAGAGG - Intronic
1047318982 8:123761284-123761306 AAGCCAGGCTTTGTTGAGAAAGG - Intergenic
1047622870 8:126626015-126626037 AATTCAGCGATTGCTGTGAAAGG + Intergenic
1048203498 8:132396692-132396714 AACCCAGGGACTGCTCTGAAGGG + Intronic
1050870712 9:10565653-10565675 AAGTTAGGGATTGGTAAGAAAGG - Intronic
1051393981 9:16599368-16599390 AAGGCAGAGATGGCTGTGAACGG + Intronic
1052542889 9:29833984-29834006 AAGCCAGGGATCCCAGAGGAAGG + Intergenic
1053036795 9:34833113-34833135 CAGCCAGGGACTACAGAGAAGGG - Intergenic
1053445454 9:38149855-38149877 GAGCCAGTGATTGCAGAGACAGG - Intergenic
1054773497 9:69105186-69105208 CACCCAGTGATTGCTGAGCATGG + Intergenic
1054797822 9:69318874-69318896 ATTCCAGGGACTGTTGAGAAAGG + Intergenic
1055070332 9:72159435-72159457 AAGGTGGGGTTTGCTGAGAAAGG - Intronic
1055120029 9:72649110-72649132 AAGTCAGGGATAGCAGAGAAAGG + Intronic
1060168647 9:121442215-121442237 AGATCAGGGATTGCTGAGAAGGG + Intergenic
1060240100 9:121896200-121896222 AAGACACGGAATGCTGGGAATGG + Intronic
1060368233 9:123042046-123042068 ATGCCAGGCATAGCTGAGAATGG + Intronic
1060892925 9:127199734-127199756 AAGGCAGGCAATGCTGTGAAGGG + Intronic
1061781059 9:132996319-132996341 AGGGCAGGGATTGCAGAGAGGGG - Intergenic
1062254818 9:135615872-135615894 AAGCCAGGGAATCCCGAGGACGG + Intergenic
1185771452 X:2768226-2768248 ATGCCTGGGATTGCTGGGATGGG + Intronic
1185833626 X:3324065-3324087 CAGCCAGCCACTGCTGAGAATGG + Exonic
1185961661 X:4551546-4551568 AAGCAAGGGAAGTCTGAGAAAGG + Intergenic
1186504582 X:10080994-10081016 AAGCCAGTGAATGGAGAGAACGG - Intronic
1187385285 X:18842978-18843000 AAGAGAGGGAATTCTGAGAAAGG - Intergenic
1187719309 X:22134796-22134818 AACCCAGGCCTTGCTGGGAAGGG - Intronic
1188263879 X:28046436-28046458 CATCCAGGTATTGCTGTGAAGGG + Intergenic
1189237708 X:39500912-39500934 CAGTAAGGCATTGCTGAGAATGG - Intergenic
1190203850 X:48385743-48385765 AGGGCAGGGATTGCTGAGTGCGG + Intronic
1190206686 X:48409660-48409682 AGGGCAGGGATTGCTGAGTGCGG - Intronic
1192024312 X:67432318-67432340 AAGCCTGGCATAGCTGAGAAGGG + Intergenic
1192620855 X:72678784-72678806 AGGACAGTGATTTCTGAGAAAGG + Intronic
1193080226 X:77399275-77399297 AAGCAATGGATGGCTGACAATGG - Intergenic
1194753415 X:97709145-97709167 AAGCCAGGCATGGCAGAGCATGG + Intergenic
1195139441 X:101944187-101944209 AAGTCTGGTATTCCTGAGAAAGG - Intergenic
1198234448 X:134723907-134723929 AGACCAGGGAGTGCTAAGAATGG + Intronic
1198423623 X:136494044-136494066 CACCTAAGGATTGCTGAGAATGG - Intergenic
1201242093 Y:11968970-11968992 CAGCCAGCCACTGCTGAGAATGG - Intergenic
1201769715 Y:17608031-17608053 ATACCAGAGATGGCTGAGAAAGG + Intergenic
1201831839 Y:18297954-18297976 ATACCAGAGATGGCTGAGAAAGG - Intergenic