ID: 1097605593

View in Genome Browser
Species Human (GRCh38)
Location 12:61749334-61749356
Sequence TGGCATACTCCTTGTGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097605593 Original CRISPR TGGCATACTCCTTGTGGGCT TGG Intronic
901275758 1:7989858-7989880 TGACAGACTCCTTGTGTGCATGG - Intergenic
902721466 1:18307026-18307048 TGGCAATTTCCTTGTGAGCTGGG + Intronic
903219503 1:21861139-21861161 TGGCAGACTCCGTAAGGGCTGGG + Intronic
906129490 1:43447657-43447679 GGGCATACTCGTTGTGTTCTGGG - Exonic
906422398 1:45680838-45680860 TGGTATACTCACTGTAGGCTAGG - Intronic
910749653 1:90615162-90615184 TGGCACAGTCCCTCTGGGCTGGG - Intergenic
916139180 1:161678792-161678814 TGGCAGTCTCCTTGAGGGTTTGG + Intergenic
916770141 1:167899772-167899794 TGGCATACCTCTTTTGGGCTCGG + Intronic
917448969 1:175130769-175130791 TGGCAAGCTCCTTGGGGGCAGGG - Intronic
917583927 1:176405762-176405784 TGACATACTCCTCATGGCCTGGG - Intergenic
919035252 1:192299270-192299292 TAGCATATTACTTGTGGGCAAGG - Intergenic
1066652966 10:37677176-37677198 TGGCATCCTCCCTGTGTGCCTGG + Intergenic
1067036513 10:42924644-42924666 TGGCATCCTCCCTGTGTGCCTGG + Intergenic
1067796159 10:49323675-49323697 TGGCTTCCTCCATGGGGGCTGGG - Exonic
1069775087 10:70922142-70922164 CTGCATACACCTTGTGGGCAGGG + Intergenic
1072659781 10:97356748-97356770 TGGCATCCTGCCTGTGGTCTGGG - Exonic
1074689612 10:115992419-115992441 TGGCACCCTCCATGGGGGCTGGG - Intergenic
1075640447 10:124060564-124060586 TTGCACACTCCTGGTGGGGTTGG - Intronic
1075846962 10:125552529-125552551 CTGCATGCTCCTTGGGGGCTGGG - Intergenic
1078006791 11:7538193-7538215 TGCGCTCCTCCTTGTGGGCTGGG + Intronic
1079331074 11:19533526-19533548 TGGCATCCTCCTGCAGGGCTGGG + Intronic
1080218679 11:29875378-29875400 TGGTAAACTCCTGGTGGTCTGGG + Intergenic
1083012568 11:59417372-59417394 TGTAATACTGCTTGTGGGCCTGG - Intergenic
1083675090 11:64320768-64320790 TGCCTTCCGCCTTGTGGGCTCGG - Exonic
1084943746 11:72627900-72627922 TGGCATCCTCCTTCAGGGCCAGG - Intronic
1087111759 11:94477567-94477589 TAGCATTCTCCTTGGGAGCTAGG - Intronic
1088152377 11:106759973-106759995 TGGCATTCTCCCTGTGGGCATGG - Intronic
1088782087 11:113145716-113145738 TGGCATTATCCTTGTGTGATTGG + Intronic
1089158656 11:116421461-116421483 TGGCATCCTCCTTGTTCTCTGGG + Intergenic
1096233870 12:49912775-49912797 TGGGTCACTCCTTGTGTGCTTGG + Intergenic
1096600499 12:52725273-52725295 GGGCCTTCTCCTTCTGGGCTGGG - Intergenic
1097605593 12:61749334-61749356 TGGCATACTCCTTGTGGGCTTGG + Intronic
1102063124 12:109950243-109950265 TGGCACACTCCATGTGTGCCTGG - Intronic
1102770424 12:115471269-115471291 TGGGATCCACCTTGTGAGCTTGG + Intergenic
1103404275 12:120664245-120664267 TAGCATAATCCATGTGTGCTGGG + Intronic
1103453782 12:121048897-121048919 TGCCATCCTCCTTGGGAGCTGGG + Intergenic
1109500911 13:63235368-63235390 TACCATCCTCCTTGTGGTCTAGG + Intergenic
1115284551 14:31703050-31703072 TGGCATATTCCTTATTTGCTAGG + Intronic
1122409691 14:101519573-101519595 AGGCATAGACCTTGTGGGGTAGG - Intergenic
1125245393 15:37630802-37630824 TGGCATAGTTTTTGTGGGGTGGG - Intergenic
1125574887 15:40748493-40748515 TGGCCTGCTCCTTGTGGCCTTGG + Intronic
1127945226 15:63744631-63744653 GGCAATACTCCTTGTGGCCTGGG - Intronic
1128684772 15:69675680-69675702 TGCCCCACTCCTTGTGGGCATGG + Intergenic
1128867015 15:71121630-71121652 TGTCAGACTACTTGTGGGCTGGG + Intronic
1129022192 15:72530660-72530682 TAGCATACTCATTTTGGTCTAGG - Intronic
1129309340 15:74695251-74695273 AGGCATAGTCCTTGTTGGCTTGG - Intronic
1130615829 15:85406943-85406965 AGACATACTCTTTGTGGCCTAGG - Intronic
1134760834 16:16713455-16713477 TTGCAAACTCCTTGAAGGCTGGG + Intergenic
1134985224 16:18645718-18645740 TTGCAAACTCCTTGAAGGCTGGG - Intergenic
1138579042 16:57927666-57927688 TGGCTTTCTGCTTGTGAGCTGGG - Intronic
1146059527 17:29597074-29597096 TGCCTTCCTCCTCGTGGGCTGGG + Intronic
1146106044 17:30038285-30038307 TGGCATAATTCTTAAGGGCTAGG - Intronic
1150788887 17:68184277-68184299 TGGCAAACTCCTGGTGACCTGGG + Intergenic
1150795459 17:68233315-68233337 GGGCTTTCTCCTTGTTGGCTAGG - Intergenic
1151110233 17:71667860-71667882 TGGTATTTTCCCTGTGGGCTTGG - Intergenic
1155367947 18:25067453-25067475 TGGAATTCTCATTTTGGGCTTGG + Intronic
1161978822 19:7620161-7620183 TGGCAATCTCCTTGAGGGCTGGG - Intronic
1162067208 19:8133089-8133111 TGGCACACTCGTTGTGGTCTGGG + Exonic
1168693972 19:58394842-58394864 TGGCATAGCCCTGGTGGCCTTGG + Intergenic
925907905 2:8550473-8550495 TGTCATAGTCCCTGTGGGCCGGG + Intergenic
929564837 2:42977837-42977859 TGGGAAGCTCCTTGTGGGCTGGG - Intergenic
933167997 2:79096162-79096184 TGGGATACTCCTTCTGTGATAGG + Intergenic
933228318 2:79776823-79776845 TAGCAAACTCCATGTGGGTTTGG - Intronic
939036645 2:137139613-137139635 TGGCAAACTACTTAAGGGCTTGG - Intronic
939781820 2:146458914-146458936 TGGCATCTTCCTTGTGGTGTTGG - Intergenic
945336608 2:208599826-208599848 AGGCATTCTCCATGAGGGCTTGG + Intronic
945839443 2:214870004-214870026 TGTAAAATTCCTTGTGGGCTGGG + Intergenic
946060993 2:216941441-216941463 TGGTAAACTCCTTGAGGGCAGGG + Intergenic
1169808087 20:9580148-9580170 TGGAATGCACATTGTGGGCTCGG + Exonic
1173319342 20:41973570-41973592 TTGCATACTTATTGTGTGCTAGG - Intergenic
1173792299 20:45835383-45835405 TTGCAAAAACCTTGTGGGCTGGG - Intronic
1175658169 20:60790009-60790031 AGGCATCCTCCTTCTGAGCTGGG + Intergenic
1178413711 21:32386996-32387018 TGGCATACTGACTGTGGGCCAGG - Intronic
1181949718 22:26545126-26545148 CAGCATATTCCTTGTAGGCTGGG - Intronic
1184856597 22:47149810-47149832 TGTCTTACTCGTTGTGGACTGGG + Intronic
958435746 3:94093507-94093529 TGGTAAACTGCATGTGGGCTGGG + Intronic
959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG + Intronic
963366662 3:144344015-144344037 TGGCATGCTCTCTGTGGACTTGG + Intergenic
966491125 3:180529715-180529737 GGCCATCCTCCTTGTGGCCTGGG + Intergenic
970266370 4:14292033-14292055 GGGCATACACCTGGTGGTCTGGG - Intergenic
970683846 4:18542802-18542824 TGGCATACTCATTATGTGCCAGG + Intergenic
972505185 4:39714338-39714360 TGACATAATCCTTGAGGGCTTGG - Intronic
972666160 4:41167186-41167208 TGGCATGCTCCAGGAGGGCTTGG - Intronic
972673807 4:41240054-41240076 TGGCATTCTCCTTGAGTGATTGG + Intergenic
973064337 4:45769428-45769450 TGGTATCCTCATTGTAGGCTTGG - Intergenic
975494750 4:75025245-75025267 TGGCACACTCCTTTTGATCTGGG + Intronic
975721909 4:77256321-77256343 TGGCATAGTCCATGTGAGGTGGG + Intronic
978904321 4:113987746-113987768 TGGCATTCTCCTTGTGGCATGGG + Intergenic
979413509 4:120407138-120407160 GGCAATACTCCTTGTGGCCTGGG + Intergenic
979591363 4:122483911-122483933 TAGAATACTCAGTGTGGGCTGGG + Intergenic
980323217 4:131306239-131306261 AGGCTTTCTCCTTGTTGGCTAGG + Intergenic
985383907 4:189425257-189425279 TTGCAAACTTCTTGTGGTCTAGG - Intergenic
985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG + Intergenic
990957081 5:61352537-61352559 TGGCATATTCTTTGTGTGATGGG - Intronic
994097280 5:95858551-95858573 CGTCATACTCCTTGTTGGATTGG - Intronic
1001698815 5:173691982-173692004 TTGCATACTCTTTGAGGGCAGGG - Intergenic
1004583352 6:16975768-16975790 TGGCAGAATCCCAGTGGGCTGGG - Intergenic
1006780318 6:36627964-36627986 TGACATAGGCCTTGAGGGCTGGG + Intergenic
1008694408 6:54017178-54017200 TGGCATACTCACCGTGCGCTAGG - Intronic
1011064608 6:83311618-83311640 TGGCATATTCCTTATGGCTTTGG - Intronic
1013783438 6:113753703-113753725 TGGAATACTTCTTCTTGGCTAGG + Intergenic
1016012969 6:139157898-139157920 TGCCCAACTCCTGGTGGGCTCGG + Intronic
1017146819 6:151241563-151241585 TGGAATATTTCTTGTGGGCCAGG + Intronic
1017990447 6:159483449-159483471 TGCCATACTATTTCTGGGCTGGG + Intergenic
1019526427 7:1482468-1482490 TTGCCTGCTCCTTGTGGGCCTGG - Intronic
1021702409 7:23332386-23332408 TGGCATACTCCATGTTTTCTAGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030987615 7:116261104-116261126 TGGCACAATCCCTGTGGGGTAGG - Intergenic
1031489576 7:122370250-122370272 TAGCAAACTCCTTGAGGGCAGGG + Intronic
1041465557 8:58154612-58154634 TGACATAGTCCTTCTGGGTTAGG - Intronic
1045986586 8:108256353-108256375 TTGTAAACTCCTTGTGGGCTGGG - Intronic
1052823181 9:33155616-33155638 CGGCCTTCTCCTTGTGGCCTGGG + Intronic
1053146291 9:35714404-35714426 TGCCATCCTCCCTCTGGGCTTGG + Intronic
1057835650 9:98442850-98442872 TGGCATTCTCCCTGTGTGCCTGG + Intronic
1062596890 9:137303552-137303574 TGGGGTCCTCCTGGTGGGCTGGG + Intergenic
1189703244 X:43733461-43733483 TGTCCTACTCGTTGGGGGCTGGG + Intronic
1190772471 X:53526774-53526796 TGGCAGCCTCCATGTGGGGTTGG + Intergenic
1191151094 X:57221445-57221467 TGGCATACTACTTCTGTGATAGG - Intergenic
1199308645 X:146297273-146297295 TGTCATACTCCTCATGGCCTGGG - Intergenic
1202051405 Y:20784546-20784568 TGGCATTTTCCCTGTGTGCTGGG + Intergenic