ID: 1097606340

View in Genome Browser
Species Human (GRCh38)
Location 12:61759075-61759097
Sequence CTTGAAATACAGAAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 545}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097606340_1097606343 7 Left 1097606340 12:61759075-61759097 CCAGCTTCCTTCTGTATTTCAAG 0: 1
1: 0
2: 2
3: 36
4: 545
Right 1097606343 12:61759105-61759127 TATTATATGTTGAAAAAGAAAGG 0: 1
1: 0
2: 4
3: 78
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097606340 Original CRISPR CTTGAAATACAGAAGGAAGC TGG (reversed) Intronic
900634235 1:3654010-3654032 CTTGAAATACAAAAATTAGCTGG + Intronic
901482958 1:9538884-9538906 CTAGAAATACAAAAGTTAGCCGG - Intergenic
901671510 1:10858765-10858787 CTGGAATTAGTGAAGGAAGCAGG + Intergenic
902309708 1:15572519-15572541 CTGAAAATACAGAAGTTAGCTGG - Exonic
902578117 1:17391379-17391401 CTAGAAATACAGAAATTAGCTGG - Intronic
903984043 1:27212039-27212061 GTGGAAATATGGAAGGAAGCTGG - Intergenic
904079873 1:27865345-27865367 CTAGAAATACACAAAGTAGCTGG + Intergenic
904099466 1:28011598-28011620 TATAAAATACAGAAGGCAGCAGG + Intronic
904522444 1:31106032-31106054 ATAGAAATACTGAAAGAAGCAGG + Intergenic
905011712 1:34751569-34751591 CTGGAAATCCAGGAGGGAGCTGG - Intronic
905344545 1:37302481-37302503 GTTGGGAGACAGAAGGAAGCTGG + Intergenic
905719526 1:40185290-40185312 CTAAAAATACAGAAAGTAGCCGG - Intronic
905804194 1:40863981-40864003 TTTTAAATAGAGAAGGGAGCGGG + Intergenic
906484676 1:46224921-46224943 CTAGAAATACAGAAATTAGCTGG - Intergenic
907207253 1:52784151-52784173 CTAAAAATACAGAAAGTAGCTGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
909892894 1:81029808-81029830 CTAAAAATACAGAAGTTAGCTGG + Intergenic
910009730 1:82446559-82446581 CTTGAGAAATAGAAAGAAGCTGG - Intergenic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
912762453 1:112381295-112381317 CTAGGAATACAGAATGAAACAGG + Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913327245 1:117637788-117637810 CTAGAAATACAGAAATTAGCTGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914924283 1:151871022-151871044 CTTGGTATAAAGAAGGAAACAGG + Intergenic
916746276 1:167687226-167687248 CTTGAAATTCACATAGAAGCAGG + Intronic
917253320 1:173087023-173087045 GCTGGAATACAGAAGTAAGCTGG - Intergenic
917506374 1:175630811-175630833 CTTGCAAAAAAAAAGGAAGCCGG + Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917693238 1:177490515-177490537 CTTGAAACCCAGCAGGATGCTGG - Intergenic
918362611 1:183774223-183774245 CCTGAACTACAGAACCAAGCAGG + Intronic
918966388 1:191354995-191355017 CTAAAAATACAGAAGTCAGCCGG - Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920452019 1:206066453-206066475 CTAAAAATACAGAAATAAGCTGG + Intronic
920530686 1:206700019-206700041 TTTTAAATAAAGAAAGAAGCAGG + Intronic
920581928 1:207117845-207117867 CTTGAAACACAGCAAGATGCAGG - Intronic
921240786 1:213179251-213179273 CTAGAAATACAGAAATTAGCTGG + Intronic
921602057 1:217116526-217116548 CTTGAAATACTGAAGGATTATGG - Intronic
921661115 1:217803854-217803876 CTAAAAATACAAAAGGTAGCCGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922869964 1:228894383-228894405 CTTAAAATTCAGGGGGAAGCTGG - Intergenic
923027138 1:230214019-230214041 AATGAAATACAGAAGGAATATGG - Intronic
923027195 1:230214406-230214428 CTTCAAAAACAAAAGTAAGCCGG - Intronic
923197226 1:231680064-231680086 CTAAAAATACAGAAGTTAGCCGG + Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923485018 1:234421248-234421270 CTAAAAATACAGAAGTTAGCTGG - Intronic
923549029 1:234946794-234946816 CATGAAATACAAAAGAAAGAAGG + Intergenic
923691524 1:236198070-236198092 CTTGTAATATAGTTGGAAGCTGG + Intronic
924534806 1:244926485-244926507 CTAAAAATACAAAAGGTAGCTGG - Intergenic
924584917 1:245353715-245353737 CTTTAAATACAGCAGGATGGTGG - Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064272345 10:13877208-13877230 CTTGACATACAGTAGGAAAATGG + Intronic
1065056636 10:21850955-21850977 CTATACATACAGAATGAAGCAGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065273469 10:24061706-24061728 CTTGCAATTCAGAAGGGAGTGGG - Intronic
1065642996 10:27804120-27804142 CATGAAAGAAAGAAGGAAACGGG + Intergenic
1065999785 10:31093417-31093439 CTTGAGTTACAGGAGGAAACAGG - Intergenic
1066300990 10:34095609-34095631 CTTGAAAGCCAGAAGGGAGTGGG + Intergenic
1066324292 10:34340787-34340809 CCAGAAAAACAGTAGGAAGCAGG + Intronic
1067926837 10:50517474-50517496 CTTAAATTACAGAATAAAGCAGG + Intronic
1069414639 10:68187208-68187230 CTAGAAATACAAAAGTTAGCTGG + Intronic
1069693733 10:70371871-70371893 CTCGAGTTACAGGAGGAAGCAGG + Intronic
1069976179 10:72215235-72215257 CTGAAAATACAGAAAGTAGCCGG + Intronic
1070389056 10:75952914-75952936 CTAAAAATACAAAAGGTAGCTGG - Intronic
1070701294 10:78603552-78603574 CTAAAAATACAGAAGTTAGCTGG - Intergenic
1070909991 10:80109577-80109599 CTAGAAATACAAAAGTTAGCCGG - Intergenic
1070914354 10:80143556-80143578 CTAAAAATACAAAAAGAAGCCGG - Intronic
1071131524 10:82398914-82398936 ACTTAAGTACAGAAGGAAGCAGG + Intronic
1071159034 10:82725159-82725181 AGTGAGATACAGAATGAAGCAGG + Intronic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1071699347 10:87913403-87913425 CTTGAAGGACAGAAGGCAGTGGG - Intronic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1072850055 10:98880617-98880639 CTTGATAATCAAAAGGAAGCAGG - Intronic
1072930029 10:99654357-99654379 ATAGAAATACAGAAGCAAACTGG - Intergenic
1072988329 10:100164496-100164518 TTTGACATGCAGAATGAAGCTGG + Intronic
1073279516 10:102342689-102342711 CTTTAGAGACAAAAGGAAGCAGG - Intronic
1074360061 10:112818522-112818544 CTTCAAATACAGCAGCAGGCAGG - Exonic
1074467792 10:113698766-113698788 CTTGAGAGACAGAAGGCAGCAGG + Intronic
1074530241 10:114292113-114292135 CTAAAAATACAAAAGGTAGCCGG + Intergenic
1075287647 10:121201096-121201118 TTAGAAGTAGAGAAGGAAGCAGG - Intergenic
1076593098 10:131603857-131603879 CTTAAAATCCAGCAGGCAGCAGG - Intergenic
1076639344 10:131903303-131903325 CTAAAAATACAGAAGTTAGCCGG + Intronic
1077786402 11:5389193-5389215 ATTGAAATACAGAGGAAAACTGG + Intronic
1078838465 11:15054932-15054954 CTAAAAATACAAAAGGTAGCTGG - Intronic
1078877170 11:15410411-15410433 CTAGGAGTTCAGAAGGAAGCAGG + Intergenic
1079068799 11:17324593-17324615 CTAAAAATACAGAAGTTAGCTGG - Intronic
1079752339 11:24214644-24214666 ATTGGAAAACAGAAAGAAGCAGG + Intergenic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1081996401 11:47367390-47367412 CTAGAAATACAAAAAGTAGCCGG + Intronic
1082033374 11:47623888-47623910 CTAGAAATACAGAAATTAGCCGG + Intronic
1084058488 11:66653521-66653543 CTAAAAATACAAAAGTAAGCTGG - Intronic
1086155367 11:83659644-83659666 CATGATATAGACAAGGAAGCTGG + Intronic
1087566436 11:99865171-99865193 ATTGAAGCACAGAAGGAAGGAGG - Intronic
1087691723 11:101328005-101328027 CATGAAATACAGAAATAAACAGG - Intergenic
1089410826 11:118241248-118241270 CTTGAGGTAGATAAGGAAGCAGG - Intronic
1090015359 11:123081305-123081327 GTTGAAAGACAAAAGGAAGCAGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1093062939 12:14626176-14626198 CTAGAAATACAGAAATTAGCCGG + Intronic
1093983879 12:25506506-25506528 CTTGAATTACAGAAGAACGCTGG + Intronic
1094081140 12:26537042-26537064 CTTCAAATAAAGCAAGAAGCTGG + Intronic
1094564538 12:31588215-31588237 CTTGAAGGACATGAGGAAGCAGG - Intronic
1094615623 12:32033812-32033834 TATGAAATACAGGAGGAAACAGG + Intergenic
1095575975 12:43739726-43739748 CTTGAAGAACAAAAGGATGCTGG + Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1097594051 12:61605776-61605798 CTTGAAGAAAAGAAGAAAGCTGG - Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1097955069 12:65476139-65476161 TTTGGAATACAGAGGGAATCTGG + Intronic
1098481206 12:70963728-70963750 TTTAAAATACAAAAGTAAGCTGG + Intergenic
1099308069 12:80982993-80983015 CTTGAATTCCAAAAGGAAGAAGG - Intronic
1099608513 12:84835771-84835793 CTAGAAATACAAAAGTTAGCTGG + Intergenic
1100271800 12:93032611-93032633 CTTGAACAAAAGAAGGAATCAGG + Intergenic
1102048740 12:109846946-109846968 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1102297950 12:111751567-111751589 CTAAAAATACAGAAGTTAGCTGG + Intronic
1102374409 12:112409847-112409869 CTAAAAATACAAAAGGTAGCCGG + Intronic
1102870777 12:116412384-116412406 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1102956066 12:117059752-117059774 CTAAAAATACAGAAGTTAGCTGG - Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1103583040 12:121930323-121930345 CTAGAAATACAAAAAGTAGCTGG + Intronic
1103772771 12:123341285-123341307 CTAAAAATACAGAAACAAGCTGG + Intronic
1104256060 12:127139882-127139904 CCAGAAATACAGAAAGGAGCTGG - Intergenic
1104444337 12:128821722-128821744 CTAGAAATACAAAAGTTAGCTGG + Intronic
1105497963 13:20946983-20947005 CTGAAAATACACAAAGAAGCTGG - Intergenic
1106129952 13:26931909-26931931 CTTTAAGGACAGAGGGAAGCTGG - Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106663520 13:31827147-31827169 CTGGTATTACAGAAAGAAGCTGG + Intergenic
1107589465 13:41887226-41887248 CTTGAAATCGAGAACGAAGAGGG + Exonic
1108160730 13:47635862-47635884 CCAGAAATACAAAAAGAAGCTGG + Intergenic
1108205070 13:48080094-48080116 TTTGAAATACAGAAGTCATCTGG + Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108362936 13:49684063-49684085 CTTTAAAGACAGAAGGCAGACGG + Intronic
1108611575 13:52088927-52088949 CTAAAAATACAGAAGTTAGCTGG + Intronic
1108705677 13:52983445-52983467 CTAGAAATACAAAAAGTAGCTGG - Intergenic
1109081943 13:57914734-57914756 CTTGAAATAGATAAAGAAGATGG + Intergenic
1110247407 13:73342256-73342278 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1110357426 13:74584139-74584161 CTGGGAATACAGAGTGAAGCGGG + Intergenic
1112020035 13:95363600-95363622 ATTGATGTTCAGAAGGAAGCTGG + Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1112697499 13:101966831-101966853 CTAGAAATACAGAAGACAGAAGG + Intronic
1112845578 13:103638849-103638871 TTTGAAAGACAGAAGGAAAATGG - Intergenic
1114462922 14:22899540-22899562 CTAGAAATACAAAAAGTAGCTGG - Intergenic
1115040589 14:28920411-28920433 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1115814314 14:37146406-37146428 CTAAAAATACAGAAGTTAGCTGG - Intronic
1115815538 14:37160766-37160788 CTAAAAATACAGAAGTTAGCTGG + Intronic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1116000492 14:39237899-39237921 CTAGAAATACAAAAAGCAGCCGG - Intronic
1116145864 14:41068503-41068525 CTTGAAAGACAAAAGGAAAAAGG + Intergenic
1116370386 14:44122560-44122582 GTTTAAATACAGAAGCAAGATGG - Intergenic
1116386687 14:44339416-44339438 TTTGAAATACAAAAGGAGACAGG - Intergenic
1116604640 14:46974426-46974448 CTTGAAAAACAAAACAAAGCTGG + Intronic
1117431963 14:55675883-55675905 AATGAAAGACAGAAGGTAGCTGG + Exonic
1117691801 14:58314955-58314977 CTAAAAATACAGAAGTTAGCCGG + Intronic
1118397457 14:65349481-65349503 CTTGAAAAAGAGAAAGAAACGGG - Intergenic
1118755274 14:68838603-68838625 TTTGAAATCCAGCAGGAAGCTGG - Intergenic
1119048112 14:71338899-71338921 CTAAAAATACAAAAAGAAGCCGG - Intronic
1119073237 14:71608731-71608753 CTAAAAATACAGAGGTAAGCCGG + Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1120950656 14:90038674-90038696 CTAAAAATACAGAATGTAGCTGG + Intronic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121510911 14:94512731-94512753 CTTGAAATTCAGGAGGAATTTGG + Intronic
1121747403 14:96308828-96308850 CTTGAAAGCCAAAGGGAAGCAGG - Intronic
1122821680 14:104349693-104349715 CTTGACCTACAGAATGCAGCAGG - Intergenic
1123105273 14:105838520-105838542 CTGGAAATTGAGAAAGAAGCCGG + Intergenic
1124267030 15:28245383-28245405 CTAAAAATACAAAAGTAAGCTGG + Intronic
1124590496 15:31049343-31049365 CTAGAAAAAGGGAAGGAAGCGGG - Intronic
1125819226 15:42613801-42613823 CTAAAAATACAGAAGTTAGCCGG + Intronic
1125970830 15:43910197-43910219 CTTGAGCTACAGGAGGAAACTGG - Intronic
1127454006 15:59141634-59141656 CTGAAAATACAGACGGTAGCTGG + Intronic
1127667723 15:61165358-61165380 CTGGAAATAAAGAGGGGAGCTGG - Intronic
1128097694 15:64970899-64970921 CTAAAAATACAGAAGTTAGCCGG - Intronic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1129281963 15:74492428-74492450 CTAAAAATACAGAAGTTAGCCGG - Intergenic
1129912991 15:79243617-79243639 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1130427806 15:83819106-83819128 CTAGAAATACAAAAATAAGCTGG + Intronic
1130537260 15:84796058-84796080 CTAAAAATACAAAAGTAAGCCGG + Intronic
1130856247 15:87842137-87842159 CTTGAAATACAGCAGTTAGGAGG + Intergenic
1131425636 15:92343567-92343589 GCTGAAATACACAGGGAAGCAGG + Intergenic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1133176240 16:4017000-4017022 TTTGAAAAAGAAAAGGAAGCTGG + Intronic
1133529506 16:6641571-6641593 CTAGAAATACAAAAGTTAGCTGG + Intronic
1133557126 16:6916183-6916205 CTGGAAATAAAGTAGGAATCAGG + Intronic
1133942836 16:10324711-10324733 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1134152005 16:11812412-11812434 CTAAAAATACAGAAGTTAGCCGG + Intergenic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1137258389 16:46798344-46798366 CTAAAAATACAAAAAGAAGCTGG + Intronic
1138354584 16:56367125-56367147 GTGGAAGGACAGAAGGAAGCTGG - Intronic
1139135161 16:64194155-64194177 TATGAAATACAGACTGAAGCTGG + Intergenic
1140163233 16:72521446-72521468 CTATAAATAAAGAAGGAAGCAGG + Intergenic
1140238497 16:73180444-73180466 CTACAAATACAGAAGGGAGGCGG + Intergenic
1140448234 16:75049164-75049186 CTAAAAATACAAAAAGAAGCTGG - Intronic
1140520371 16:75575745-75575767 CTAAAAATACAAAAGTAAGCCGG - Intronic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1141236140 16:82218986-82219008 TTTTAAACACAAAAGGAAGCCGG - Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1142873330 17:2835567-2835589 CTTTAAATACAGAACAGAGCTGG + Intronic
1142970422 17:3607696-3607718 CTAGAAATACAAAAGTTAGCTGG - Intergenic
1143375557 17:6464772-6464794 CTGGAAGGACAGAAAGAAGCTGG + Intronic
1144704093 17:17356085-17356107 CTTAAAATTTAGAAAGAAGCAGG + Intergenic
1145272949 17:21414311-21414333 CTTAAAATACAAAAGTTAGCTGG + Intronic
1145311152 17:21701747-21701769 CTTAAAATACAAAAGTTAGCTGG + Intronic
1146594620 17:34157618-34157640 CTAAAAATGCAGAAGGAAGGGGG + Intronic
1146980161 17:37152860-37152882 CTGGAAATGAAGAAGGGAGCAGG - Intronic
1147282347 17:39372355-39372377 CTTAAAATACAGAAATTAGCTGG + Intronic
1147514036 17:41098973-41098995 CTAAAAATACAAAAGTAAGCTGG - Intronic
1147516133 17:41119187-41119209 CTAAAAATACAAAAGTAAGCTGG - Intergenic
1147616040 17:41828496-41828518 CTAAAAATACAGAAATAAGCCGG - Intronic
1147643793 17:42021541-42021563 CTTGAAGAACAGAAGCACGCTGG - Intronic
1148017434 17:44531980-44532002 CTTAAAATACAGAAATTAGCTGG + Intergenic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149525741 17:57354408-57354430 ATAGAAATACAGAAGTGAGCAGG + Intronic
1149810796 17:59669105-59669127 TTTGAAATACGGAAGGAAATTGG + Intronic
1149878899 17:60267680-60267702 CTAGAAATACAAAAGTTAGCCGG - Intronic
1150068010 17:62127745-62127767 TTTGTAAGACAGAAGGAACCCGG + Intergenic
1150347763 17:64417556-64417578 CTAAAAATACAAAAGTAAGCTGG - Intergenic
1150426340 17:65079932-65079954 ACAGAAATACAGAAGGAAGGTGG - Intergenic
1150605068 17:66683759-66683781 CTAAAAATACAAAAAGAAGCCGG - Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1151832027 17:76558543-76558565 CTTGAACTTCAGAATAAAGCAGG - Intergenic
1151841842 17:76624409-76624431 CTAAAAATACAAAAGTAAGCCGG - Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152329484 17:79663942-79663964 CTTGAAATCCAGAAAGGACCAGG + Intergenic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153238368 18:3010016-3010038 CTTGATTTTCAGCAGGAAGCTGG - Intronic
1154203503 18:12317586-12317608 TTAGAAATACAGAAAGAGGCTGG - Intronic
1155138149 18:23017191-23017213 CTAAAAATACAAAAGTAAGCTGG + Intronic
1155189617 18:23417953-23417975 ATTGAAATACTGAAGGACCCTGG - Intronic
1155811251 18:30238588-30238610 CTGGAAATACACAAAGAAACTGG - Intergenic
1156150585 18:34237013-34237035 CTTGTAAAATAGAAGGAACCAGG - Intergenic
1156342317 18:36220757-36220779 CTAAAAATACAAAAAGAAGCTGG + Intronic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158263540 18:55635345-55635367 CTAAAAATACAGAAGTTAGCCGG + Intronic
1158319385 18:56246722-56246744 CTAAAAATACAAAAGTAAGCTGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159430933 18:68352176-68352198 TTTGAAAAACAGAAGAAAACAGG + Intergenic
1159672008 18:71232677-71232699 CTAAAAATACAAAAGTAAGCTGG + Intergenic
1159750237 18:72291968-72291990 TGTGAAATGCAGAAGGAACCTGG - Intergenic
1159829710 18:73260606-73260628 CATGAAAAATGGAAGGAAGCTGG - Intronic
1159957249 18:74527917-74527939 CTTGAAAAAGAGAACAAAGCTGG + Intergenic
1160109904 18:76016508-76016530 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1161639389 19:5411413-5411435 CTAGAAATACAAAAGTTAGCTGG - Intergenic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162765572 19:12917522-12917544 CTAAAAATACAGAAGTTAGCTGG - Intronic
1162984826 19:14263008-14263030 CTTAAAATACAAAAAGTAGCTGG + Intergenic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1164315611 19:24085608-24085630 CTTAAAATACAGAAATAAACCGG + Intronic
1164879667 19:31721337-31721359 CTTGTGAATCAGAAGGAAGCAGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166609610 19:44179016-44179038 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1166664044 19:44666506-44666528 CTAGAAATACAAAAATAAGCCGG + Intronic
1166943035 19:46379213-46379235 CTAAAAATACAGAAGTTAGCTGG - Intronic
1166987931 19:46673311-46673333 CTTGAAAGACTGAAGGCAGAGGG - Intergenic
1167800974 19:51741719-51741741 CTGGAAATACAAAAAGTAGCCGG - Intergenic
1167910222 19:52695804-52695826 CTAAAAATACAGAAGTTAGCCGG - Intergenic
1167918014 19:52757945-52757967 CTAAAAATACAGAAGTTAGCCGG - Intergenic
1168043853 19:53780031-53780053 CTAAAAATACAAAAGGTAGCTGG + Intergenic
1168088085 19:54063174-54063196 CTTAAAATACAAAAGTCAGCCGG + Intronic
1168329461 19:55558658-55558680 CTAAAAATACAGAAGTTAGCCGG - Intergenic
926029643 2:9575059-9575081 CTAGAAATACAAAAGTTAGCTGG - Intergenic
926031403 2:9593368-9593390 CTAAAAATACAAAAGTAAGCTGG - Intronic
926130981 2:10302978-10303000 CCAGAAAGACAAAAGGAAGCCGG - Intronic
926167979 2:10533516-10533538 CTAGAAATACAAAAGTTAGCAGG - Intergenic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
926475461 2:13315488-13315510 GATAAAATACAGAAGGAAGGGGG - Intergenic
926489098 2:13501564-13501586 CTAAAAATACAGAAAGTAGCCGG + Intergenic
926656895 2:15417187-15417209 CTTGAAATACATAAGTAATTGGG + Intronic
926703595 2:15820657-15820679 CTTGAGATACAAAATGAGGCCGG + Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927128724 2:20038585-20038607 CTAGAAATACAGAAATTAGCTGG - Intronic
927294451 2:21438316-21438338 GGAGAAATACAGAAGGAAGAGGG - Intergenic
927837472 2:26411633-26411655 CTAGAAATACAAAAGTTAGCTGG + Intronic
928349901 2:30540824-30540846 CTTAAAATACAAAAAGTAGCCGG - Intronic
928789219 2:34931415-34931437 CATCAAATAAGGAAGGAAGCAGG + Intergenic
929104902 2:38355286-38355308 CTAAAAATACAGAAGTTAGCTGG - Intronic
930350976 2:50253992-50254014 CTAGAGATACAGAGGGGAGCTGG - Intronic
930368952 2:50479933-50479955 CTAAAAATACAGAAGTTAGCCGG - Intronic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
931819685 2:65938813-65938835 CTTGAAAAAACGAAGGAGGCTGG + Intergenic
934097466 2:88619790-88619812 CTAAAAATACAAAAGTAAGCCGG + Intronic
934119891 2:88828643-88828665 CTTTGAATACAGGAGGATGCTGG + Intergenic
935400087 2:102651219-102651241 TTTGAAAAACAGAAGCAGGCAGG - Intronic
935649844 2:105372851-105372873 TTCAAAATACAGAAAGAAGCTGG - Intronic
936163368 2:110101178-110101200 CTTCGAATACAGGAGGATGCTGG + Intronic
936881942 2:117263918-117263940 CTTGCAAGACAGAAGGAAGTGGG - Intergenic
939097108 2:137845496-137845518 CTTTAAATAGAGATTGAAGCTGG + Intergenic
939277963 2:140026327-140026349 CTAGAAATACAAAAGTCAGCTGG - Intergenic
939407214 2:141773792-141773814 CTTGAAATACAAAAGCATGATGG + Intronic
939750981 2:146045434-146045456 CTTGAGAGAAAGAAGGCAGCAGG + Intergenic
940378881 2:152990419-152990441 CTTGAGATACCAAAGGAAGCGGG + Intergenic
940701554 2:157050447-157050469 CTAAAAATACAGAAGTTAGCTGG - Intergenic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
941339105 2:164283600-164283622 GGTGAAATTCAGAAGGCAGCAGG + Intergenic
941594953 2:167465045-167465067 ATTAAAATACAGCAGGTAGCAGG - Intergenic
941797388 2:169615208-169615230 CTAAAAATACAGAAGTTAGCTGG - Intronic
942417974 2:175778568-175778590 CTGGTATAACAGAAGGAAGCTGG - Intergenic
942843010 2:180386869-180386891 CTTGAAGTAAAGAATGAAGTTGG - Intergenic
943009993 2:182435777-182435799 CTTAAAATACGGAGGAAAGCTGG - Intronic
943680461 2:190761752-190761774 CTAAAAATACAGAAGTTAGCCGG - Intergenic
943757952 2:191577092-191577114 TTTAAAATACAGAAGGGAGATGG - Intergenic
943986903 2:194634047-194634069 CTTAAAATAAAGAAAGAAGGGGG + Intergenic
944147154 2:196518142-196518164 CTTGAAAAACAGAAGAAAGGAGG - Intronic
944343650 2:198634250-198634272 CTTAAAATACAAAAGTTAGCCGG + Intergenic
944385420 2:199158367-199158389 CCAGAAATACAAAAAGAAGCTGG + Intergenic
945576510 2:211536643-211536665 CTTGAAATTAAGAAAGAAGCAGG + Intronic
946821932 2:223639061-223639083 TTTGAAAGGCAGAAGGATGCAGG - Intergenic
946983483 2:225245898-225245920 CAACAAATTCAGAAGGAAGCTGG + Intergenic
947323904 2:228953811-228953833 CCAGAAAAACAGAAGAAAGCTGG + Intronic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947485265 2:230542049-230542071 ATTGAAAGAGAAAAGGAAGCAGG - Intronic
947899052 2:233704972-233704994 CTTAAAATACAGAAATTAGCCGG + Intronic
948040756 2:234899781-234899803 CTAGAAATACAAAAATAAGCTGG + Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948167031 2:235870843-235870865 CTTTAAGTACAGCAGGAAGCAGG - Intronic
948633761 2:239320219-239320241 CTTAAAATACAAAAGTTAGCTGG + Intronic
1169843193 20:9961968-9961990 TTTGAAATCCAGAAGTCAGCTGG - Intergenic
1170257495 20:14361442-14361464 CTTGAAATCTAGAATGGAGCTGG + Intronic
1170898726 20:20439372-20439394 CAAGAAATACAGAAGTTAGCTGG - Intronic
1171110143 20:22473251-22473273 CTTTAACTACAAAAGAAAGCAGG + Intergenic
1171161866 20:22933346-22933368 CTTGGAATTCAGAAGAAAGATGG + Intergenic
1171511598 20:25689983-25690005 CATTAAAAACAGAAGGCAGCTGG + Intronic
1172253309 20:33495234-33495256 CTAAAAATACAAAAAGAAGCTGG + Intronic
1172389234 20:34555304-34555326 CTAAAAATACAGAAGTTAGCTGG - Intronic
1172732796 20:37102322-37102344 CTTGAAATACAAAAATTAGCCGG - Intronic
1172743836 20:37191313-37191335 CTAAAAATACAGAAGTTAGCTGG + Intronic
1173565068 20:44032628-44032650 CTTGAGATATAGTAGGGAGCTGG + Intronic
1174236181 20:49094174-49094196 CCTGAAATTCAGAAGGTATCTGG + Exonic
1174241749 20:49141731-49141753 CTAAAAATACAGAAAGTAGCCGG + Intronic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1174619735 20:51864857-51864879 CTGAAAATACAGAAGTTAGCCGG + Intergenic
1174839279 20:53886363-53886385 CTTGAATTACAAAAGGGAGGAGG - Intergenic
1175907348 20:62387333-62387355 CTCGAAATGCAGAACGACGCCGG + Exonic
1176384491 21:6131771-6131793 CTAAAAATACAGAAGTTAGCCGG + Intergenic
1177081341 21:16641863-16641885 ATTGTAATACAGAAGAAATCTGG + Intergenic
1177092223 21:16783345-16783367 CTAGAAGTACAAAAGGGAGCTGG + Intergenic
1178127716 21:29533538-29533560 CTAGAAATCCAGAAACAAGCAGG - Intronic
1178966399 21:37123440-37123462 TTTGAAAGACATCAGGAAGCTGG - Intronic
1179208146 21:39302896-39302918 CTAAAAATACAGAAAGTAGCTGG + Intronic
1179738981 21:43406481-43406503 CTAAAAATACAGAAGTTAGCCGG - Intergenic
1180947292 22:19703433-19703455 ATTAAAATACAGAGGGAAGCCGG - Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182657341 22:31901079-31901101 CTTAAAATACAAAAGTTAGCCGG + Intronic
1183661406 22:39223791-39223813 CTTTACAAACTGAAGGAAGCAGG + Exonic
1184077969 22:42195659-42195681 CTAAAAATACAGAAGTTAGCTGG - Intronic
1184423676 22:44396441-44396463 CCTGAATTATAGAAGGATGCTGG - Intergenic
949469000 3:4374766-4374788 CTTCAAATAGAGAAGCAATCTGG + Intronic
950350001 3:12340494-12340516 ATTGAAACACAGAGGGAAGGAGG - Intronic
950725848 3:14916474-14916496 CTGGAAGTACAGCAGCAAGCAGG + Intronic
950930506 3:16784257-16784279 ATAGAAATACAGAAGAAATCAGG + Intergenic
952030876 3:29141325-29141347 CTTGAAACAGAGAAGAAAGCAGG + Intergenic
952167879 3:30770728-30770750 ATTAAAATAAAGAATGAAGCTGG - Intronic
952282759 3:31939304-31939326 CTTGAAATACAAAAATTAGCTGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954668087 3:52270279-52270301 CTAAAAATACAGAAGTTAGCTGG - Intronic
955123997 3:56091246-56091268 TTTGAGATACAGAAGACAGCTGG + Intronic
955510619 3:59676958-59676980 CTAGAAATACAGAGGTAAACAGG + Intergenic
956502058 3:69897369-69897391 CTTGCCAGACAGAAGGAAGAAGG + Intronic
956531715 3:70227128-70227150 CTTGAAATACAGGTTAAAGCAGG + Intergenic
956839752 3:73127338-73127360 CTTGAAAAAAAGAATGAAACAGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960883391 3:122369377-122369399 CTTCAGCTACAGAAGGAAGCTGG + Intronic
960968333 3:123121048-123121070 CTTGAAATACCTAAGAAATCGGG - Intronic
961034537 3:123633286-123633308 CAAGAAATACATAAGGTAGCTGG - Intronic
962683362 3:137822960-137822982 CGTGAAATACAGAAGCTACCCGG + Intergenic
962782827 3:138737229-138737251 CTAAAAATACAAAAAGAAGCTGG + Intronic
963836268 3:150060925-150060947 TTGGAAATAGAGAAGGAGGCTGG - Intergenic
963908696 3:150796387-150796409 CTAGAAATACAGAAATTAGCTGG - Intergenic
964853039 3:161115646-161115668 CTTGCAAAATAGAAAGAAGCAGG + Intronic
964967710 3:162518284-162518306 CTAGGGGTACAGAAGGAAGCTGG - Intergenic
965566965 3:170129859-170129881 CTAAAAATACAGAAGTTAGCCGG - Intronic
965577053 3:170228301-170228323 ATAGAAATACAGAAAGAGGCTGG + Intronic
965682601 3:171266838-171266860 TTTGGAGAACAGAAGGAAGCCGG - Intronic
965746367 3:171930049-171930071 CTTAAAATACAAAAGTTAGCTGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966569353 3:181423811-181423833 CTAAAAATACAGAAGTTAGCTGG + Intergenic
967063181 3:185890589-185890611 CTAAAAATACAGAAAGTAGCTGG + Intergenic
967898796 3:194425505-194425527 CTTGTAATACAACAGGAAGCGGG - Exonic
967959393 3:194908395-194908417 CATGAGAGACAGAAGCAAGCAGG - Intergenic
968209479 3:196836628-196836650 CTTAAAATACAGAAATTAGCTGG - Intergenic
968338456 3:197934344-197934366 CTAAAAATACAGAAGTTAGCTGG - Intronic
968862776 4:3185749-3185771 CTAGAAATACAAAAAGTAGCTGG + Intronic
969567541 4:7987669-7987691 CCTGGAATACCAAAGGAAGCTGG - Intronic
970165248 4:13230278-13230300 CTAGAAATACAAAAAGGAGCTGG + Intergenic
971819791 4:31537244-31537266 AATGAAAAACAGAAGCAAGCTGG - Intergenic
972339331 4:38137405-38137427 CTGGAAGGAGAGAAGGAAGCGGG + Exonic
972356485 4:38283775-38283797 CTTAAAATACCGCAGGGAGCTGG - Intergenic
972627861 4:40818796-40818818 TTTGAAATAGAGCAGGAAGGAGG - Intronic
973128555 4:46620307-46620329 TTTCAAATAGACAAGGAAGCAGG - Intergenic
974012804 4:56623072-56623094 CTAGAAAGGCAGCAGGAAGCTGG - Intergenic
974050834 4:56940062-56940084 CTAAAAATACAGAAGTTAGCCGG + Intergenic
974802627 4:66838047-66838069 CTAAAAATACAGAAGTTAGCTGG - Intergenic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
975499124 4:75065742-75065764 TTTGAAAGTCAGAAGGAAGTAGG - Intergenic
975996853 4:80325263-80325285 GTTGAAACACAGTAGGTAGCTGG + Intronic
976192784 4:82504363-82504385 CTAAAAATACAGAAGTTAGCCGG - Intronic
976430991 4:84964169-84964191 CATGAAATTAAGAAAGAAGCAGG + Intronic
976538677 4:86247110-86247132 CTTAAAGTAAAGAAGGAAGAGGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
979726312 4:123966612-123966634 CTAAAAATACAAAAGGTAGCTGG + Intergenic
980381806 4:132030884-132030906 CTAAAAATACAAAAAGAAGCTGG - Intergenic
980466223 4:133186877-133186899 CTAGAAATACAAAAGTTAGCAGG - Intronic
980890522 4:138810026-138810048 CTGGAAATACATAATGAAGTAGG + Intergenic
981270166 4:142837002-142837024 CTTAAAATACAAAAGTTAGCAGG + Intronic
982016805 4:151162734-151162756 CTAGAAATACAAAAATAAGCCGG - Intronic
982688995 4:158527379-158527401 CTAAAAATACAGAAGTTAGCCGG + Intronic
983210698 4:164954937-164954959 CTAGAAATACAGAAGTTAGCTGG + Intronic
983853349 4:172611005-172611027 AATGAAAAACAGAAAGAAGCAGG - Intronic
983945086 4:173577170-173577192 CTTGAAATACAAAAGTAATTAGG + Intergenic
984427773 4:179609547-179609569 CTGAAAATACAGAAGTTAGCCGG + Intergenic
984636952 4:182121157-182121179 CTAAAAATACAGAAGTTAGCCGG - Intergenic
984997974 4:185454550-185454572 CTAAAAATACAGAAATAAGCTGG + Intronic
1202762962 4_GL000008v2_random:127447-127469 CTTCAGCTACACAAGGAAGCAGG - Intergenic
986425924 5:7631460-7631482 CTTGAAAGACAGAAGGGCCCTGG - Intronic
986604100 5:9504432-9504454 CTAGAGATGCAGAAGTAAGCAGG + Intronic
986924964 5:12735432-12735454 ATTGGTATACACAAGGAAGCAGG + Intergenic
987213574 5:15709576-15709598 CTTCAAATACAGACAGAATCAGG + Intronic
987730816 5:21770460-21770482 CTAGAAATACAAAAAGTAGCTGG + Intronic
987749061 5:22016545-22016567 CTAAAAATACAGAAGTTAGCTGG - Intronic
987804215 5:22742017-22742039 CTAAAAATACAAAAGGTAGCTGG + Intronic
987873500 5:23649497-23649519 CTTGAAACAGAGAACTAAGCAGG + Intergenic
988050102 5:26016462-26016484 CATGAAAAAGAGAATGAAGCTGG + Intergenic
988497098 5:31754563-31754585 CTTAAAATACACAAAGAAGCTGG - Intronic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989398258 5:40981599-40981621 CTTGGAATCCAGCAGGCAGCTGG + Exonic
989982012 5:50656479-50656501 CTTAAAATACAAAAAGTAGCTGG - Intergenic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991585944 5:68202030-68202052 CATGAAAAACAGGAGGAACCAGG - Intergenic
992957143 5:81921833-81921855 CTTCAAAAACAGAATGAAACTGG - Intergenic
993077984 5:83259161-83259183 ATTGAAATACAGACTGATGCAGG - Intronic
994315675 5:98330410-98330432 CCTAAAATACAGAAGGCATCCGG + Intergenic
994617584 5:102125199-102125221 CTTCAAAAACAGCAGGAATCAGG - Intergenic
995333054 5:110966960-110966982 CTTGAAATAGAGAAGTAACTGGG - Intergenic
995998015 5:118323975-118323997 CTAAAAATACAGAAAGTAGCTGG + Intergenic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
1001643704 5:173264433-173264455 CTTGGAATACATAATGAAGAGGG - Intergenic
1001825486 5:174741882-174741904 CATGAAGTAGAGGAGGAAGCAGG + Intergenic
1001857064 5:175022114-175022136 TTTGAGAAACAGAAAGAAGCGGG + Intergenic
1001977549 5:176012536-176012558 CTTAAAATACAGAAATTAGCCGG + Intronic
1002239872 5:177831233-177831255 CTTAAAATACAGAAATTAGCCGG - Intergenic
1002255823 5:177958075-177958097 ATTAAAATACAAAAGGAGGCCGG - Intergenic
1003845173 6:10166368-10166390 CTTAAAATACATAAGGAAGCAGG + Intronic
1006286182 6:33096287-33096309 CATGAAATACAAAAGTACGCCGG + Intergenic
1006483404 6:34317344-34317366 CTTTAAATACAGTAGGTAGGTGG - Intronic
1006863459 6:37189415-37189437 CTTCAAAGACAGAGGGAAACAGG + Intergenic
1007213128 6:40213229-40213251 CTAAAAATACAGAAAGTAGCCGG - Intergenic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1009830966 6:68933871-68933893 CATGAAACACAAAAGGAAACTGG - Intronic
1009965436 6:70573423-70573445 CTTGAAATACAAAAATTAGCTGG - Intronic
1010164541 6:72899997-72900019 CTAAAAATACAAAAGGTAGCAGG - Intronic
1010569313 6:77458829-77458851 CTTAAAATACAGGAGGAACTGGG - Intergenic
1012875048 6:104716526-104716548 CTAAAAATACAAAAGTAAGCTGG + Intergenic
1013863911 6:114670970-114670992 CTTCAAAAACAGAAAGCAGCAGG - Intergenic
1013988021 6:116219798-116219820 CTAAAAATACAGAAGTTAGCTGG + Intronic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1014830249 6:126094916-126094938 TTTGAAATAATGAAAGAAGCCGG + Intergenic
1015352784 6:132242300-132242322 CTAAAAATACAGAAGTTAGCTGG - Intergenic
1015413266 6:132918748-132918770 ATTAAAATAAAGAAGGAAACAGG + Intergenic
1016283497 6:142447171-142447193 CTTGAAATAAAGATGGAAGGAGG - Intergenic
1016347291 6:143127847-143127869 CTAAAAATACAAAAGGTAGCTGG - Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1017105682 6:150885355-150885377 CTAAAAATACAAAAGGTAGCTGG - Intronic
1017450769 6:154552534-154552556 CTGAAAATACAGAAGTTAGCTGG - Intergenic
1018219806 6:161566566-161566588 CTAAAAATACAGAAGTTAGCTGG - Intronic
1019800045 7:3081592-3081614 CTGGAAATACAAAAATAAGCTGG + Intergenic
1020101777 7:5397828-5397850 CATGAAATCCACAAGGAGGCTGG - Intronic
1020205856 7:6115183-6115205 CCTGAAATACAGGGGGAAGAGGG - Intronic
1020293572 7:6741385-6741407 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1021253367 7:18359192-18359214 CTAGAAATACAAAAGGTAGCCGG + Intronic
1021352142 7:19607642-19607664 CTTGAAAAAAAGAACAAAGCTGG + Intergenic
1022244439 7:28544780-28544802 CTGGAAACAGAGAAGGGAGCTGG + Intronic
1022968950 7:35499337-35499359 CTTGGAACAACGAAGGAAGCAGG - Intergenic
1023379164 7:39588741-39588763 TTTAAAACTCAGAAGGAAGCAGG - Intronic
1024216073 7:47249099-47249121 CTTGAAATCCACAAGCAAGTAGG + Intergenic
1024443659 7:49452265-49452287 CTAGAAATTCAGATGAAAGCAGG + Intergenic
1024846755 7:53653566-53653588 ATAGACATACAGAAGGAAGAAGG - Intergenic
1026073661 7:67145684-67145706 CTTGAAATACAGTGGGCAGCAGG - Intronic
1026703225 7:72666492-72666514 CTTGAAATACAGTGGGCAGCAGG + Intronic
1026733926 7:72936571-72936593 CTAGAAATACAAAAACAAGCTGG - Intronic
1026784207 7:73291141-73291163 CTAGAAATACAAAAACAAGCTGG - Intergenic
1027002974 7:74667179-74667201 CTGAAAATACAGAAGTTAGCTGG + Intronic
1027732225 7:81888935-81888957 GTGGAGATACAAAAGGAAGCTGG + Intergenic
1028054050 7:86221921-86221943 CATGAAAAACAGAAAAAAGCAGG + Intergenic
1029400657 7:100343561-100343583 CTAAAAATACAAAAGGTAGCTGG - Intronic
1031288181 7:119899475-119899497 AATGAAATACATAAGGAAACAGG - Intergenic
1031604659 7:123754104-123754126 CTTCAAATACTGAAGAAAACTGG - Intergenic
1032173194 7:129602674-129602696 CTATAAATACAGAAAGTAGCTGG + Intergenic
1032358386 7:131230957-131230979 CTAAAAATACAGAAGTTAGCTGG + Intronic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1033422391 7:141215485-141215507 CTAAAAATACAGAAGTTAGCTGG - Intronic
1033520237 7:142153161-142153183 CTAAAAATACAGAAGTTAGCTGG - Intronic
1034068751 7:148162138-148162160 TTTAAAAGACAGATGGAAGCAGG + Intronic
1034763094 7:153692270-153692292 GTTGAGGTAAAGAAGGAAGCAGG + Intergenic
1035247497 7:157573401-157573423 TGTGAAACACAGCAGGAAGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035870422 8:3131631-3131653 CTTAAAATACAAAAAGTAGCTGG - Intronic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1035889240 8:3325660-3325682 CTAAAAATACAGAAGTTAGCTGG + Intronic
1036717947 8:11144303-11144325 CATGAAATAAAGGAAGAAGCGGG + Intronic
1036723261 8:11198257-11198279 CTTGAAATACTGCAGGAACATGG - Intronic
1036950173 8:13132962-13132984 CTTGATGTGCAGAAAGAAGCCGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038487477 8:27947171-27947193 CTAAAAATACAAAAGGTAGCCGG - Intronic
1039625172 8:39042522-39042544 CTTTGAATACTGAAGGACGCTGG - Intronic
1039954405 8:42196012-42196034 CTTGAAATAAAGAAGTAACTTGG - Intronic
1040737214 8:50522738-50522760 CTAAAAATACAGAAATAAGCCGG - Intronic
1041267403 8:56078386-56078408 CCTGAAATACAAAAGTTAGCCGG - Intergenic
1041677692 8:60552162-60552184 CTAAAAATACAGAAAGTAGCTGG - Intronic
1041710962 8:60894070-60894092 TTTGTAATAAAAAAGGAAGCAGG - Intergenic
1042311487 8:67383106-67383128 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1042331820 8:67588466-67588488 CTTGCAATAGAGAAGGAAGGAGG + Intronic
1042778678 8:72465896-72465918 GCTGAAATACAGAAGAGAGCAGG - Intergenic
1043980756 8:86636408-86636430 CTTAAAATACAAAAAGTAGCCGG + Intronic
1044471115 8:92569174-92569196 CTTGACATAAAGGAGAAAGCAGG - Intergenic
1044999319 8:97866731-97866753 CTAAAAATACAAAAGGTAGCCGG - Intergenic
1046437323 8:114208390-114208412 GTTGAATTGCTGAAGGAAGCAGG - Intergenic
1046531611 8:115453180-115453202 CTAAAAATACAAAAGGTAGCTGG - Intronic
1046923037 8:119754519-119754541 CTAAAAATACAGAAGTTAGCTGG + Intronic
1047353552 8:124098732-124098754 CTTGAAATATGGAAGGATTCTGG + Intronic
1047360857 8:124167846-124167868 CTTGAATGACAGAAGAAACCTGG - Intergenic
1048234952 8:132680777-132680799 ATGGAAATAAAGAAGGAAGGAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1050074739 9:1851885-1851907 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1051846031 9:21452156-21452178 CTAGAAATACAAAAGTTAGCCGG + Intergenic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052148954 9:25088527-25088549 CTTAAAATACAAAAAGTAGCTGG - Intergenic
1052393086 9:27904214-27904236 CTTAAAATTCATAAGGAAACAGG + Intergenic
1052474837 9:28945684-28945706 TTTTAAATACAGAGGGTAGCAGG - Intergenic
1052480039 9:29012194-29012216 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1054148052 9:61578043-61578065 ATTAAAATACAAAAGGTAGCCGG - Intergenic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1055371342 9:75602865-75602887 CTTGAAATTCAGAAGAATGCAGG - Intergenic
1057060305 9:91998293-91998315 CTAAAAATACAGAAGACAGCCGG + Intergenic
1057155678 9:92837060-92837082 CTTGAAATCCAGCAGGATGGAGG + Intergenic
1057227996 9:93302557-93302579 TTTGAAATATAGAAGGATCCTGG + Intronic
1057334486 9:94145086-94145108 CTAGCAAGACAGAAGGCAGCTGG + Intergenic
1057360934 9:94373440-94373462 CTAAAAATACAGAAGTTAGCCGG - Intergenic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057662406 9:97014676-97014698 CTAAAAATACAGAAGTTAGCCGG + Intergenic
1057940935 9:99283578-99283600 GTAGAACTACAGGAGGAAGCGGG + Intergenic
1058206509 9:102115403-102115425 CTTGCACTGCTGAAGGAAGCTGG + Intergenic
1058411294 9:104735601-104735623 CTAAAAATACAGAAGTTAGCTGG - Intergenic
1059845264 9:118268535-118268557 CTTGACATACTGGAGGAAGAAGG + Intergenic
1060340360 9:122769844-122769866 AATGAAATACAGAAAAAAGCAGG + Intergenic
1060771858 9:126337746-126337768 TTTGAGATACAGATGGATGCTGG + Intronic
1060925606 9:127453241-127453263 CTAAAAATACACAAAGAAGCTGG - Intronic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1203543725 Un_KI270743v1:112328-112350 CTTCAGCTACACAAGGAAGCAGG - Intergenic
1185472769 X:394607-394629 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1186234616 X:7494063-7494085 CTAAAAATACAGAAGGTCGCTGG + Intergenic
1187121145 X:16407604-16407626 CTTAAAAAAAAGAAGGCAGCAGG + Intergenic
1187424126 X:19161705-19161727 CTAAAAATACAGAAGTTAGCTGG + Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1190030435 X:46967465-46967487 TATGAAACACAGAAGAAAGCAGG - Intronic
1190047813 X:47126807-47126829 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1190294072 X:49014136-49014158 CTTAAAATACAGAAATTAGCTGG + Intergenic
1190840233 X:54137112-54137134 CTAAAAATACAGAAGTTAGCTGG - Intronic
1191048663 X:56167290-56167312 CTAAAAATACAAAAGGTAGCTGG - Intergenic
1192057707 X:67788994-67789016 CTTGTGATTTAGAAGGAAGCTGG + Intergenic
1192138089 X:68624281-68624303 CTAGAAATACAAAAGATAGCTGG - Intergenic
1192494737 X:71608165-71608187 CTTGAACTAGAGTAGGAACCAGG + Intronic
1193212853 X:78827988-78828010 ACTGAAATACAGCAGGAAACAGG - Intergenic
1193696253 X:84710137-84710159 CTTGAAATCCAAAAGGGAGGAGG + Intergenic
1194087432 X:89546196-89546218 CCTGTAATAGTGAAGGAAGCAGG - Intergenic
1194557971 X:95385923-95385945 CTGGAAATCCAGAAGAAAACTGG + Intergenic
1194740964 X:97573820-97573842 CTGAAAATACAGAAAGTAGCAGG - Intronic
1195385662 X:104311738-104311760 CTAGAAATACAAAAGTTAGCTGG - Intergenic
1195407244 X:104528647-104528669 CTTGAACAAAAGAAGAAAGCAGG + Intergenic
1195447852 X:104974605-104974627 CATCAAATAAAGAAGGAAGCTGG + Intronic
1196260932 X:113580511-113580533 CTTGTAGTCCAGAAGGAAGAGGG - Intergenic
1196623640 X:117852838-117852860 CTTGAAATACAGAAAGAAACTGG + Intergenic
1197604642 X:128571040-128571062 CTTCAAATACAGATGGATGTGGG - Intergenic
1197994179 X:132354370-132354392 CTAGAAATACAGAAGTTAGCTGG + Intergenic
1198772704 X:140147847-140147869 CTTGAAATCCAGGAGGAAATGGG + Intergenic
1200440079 Y:3202068-3202090 CCTGTAATAGTGAAGGAAGCAGG - Intergenic
1200901951 Y:8441679-8441701 CTAGAATTACCAAAGGAAGCAGG + Intergenic
1201369515 Y:13246585-13246607 ATTAAAATACAGAAGCATGCTGG + Intergenic
1201585917 Y:15560907-15560929 CTAGAAATACAAAAGGAGGCTGG - Intergenic