ID: 1097610320

View in Genome Browser
Species Human (GRCh38)
Location 12:61812010-61812032
Sequence ATATTGTAAGAGATGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097610314_1097610320 1 Left 1097610314 12:61811986-61812008 CCTATCCTCTTTCCCCTATGTGG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG 0: 1
1: 0
2: 0
3: 26
4: 308
1097610313_1097610320 2 Left 1097610313 12:61811985-61812007 CCCTATCCTCTTTCCCCTATGTG 0: 1
1: 0
2: 0
3: 18
4: 324
Right 1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG 0: 1
1: 0
2: 0
3: 26
4: 308
1097610316_1097610320 -4 Left 1097610316 12:61811991-61812013 CCTCTTTCCCCTATGTGGTATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG 0: 1
1: 0
2: 0
3: 26
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097610320 Original CRISPR ATATTGTAAGAGATGTATTG TGG Intronic
900248656 1:1653668-1653690 ATCTTTTAACAGATTTATTGGGG - Intronic
901372847 1:8815327-8815349 ATATTATAAAGGTTGTATTGAGG - Intronic
903092613 1:20935430-20935452 ATATTGAAGGAAATGTATTTTGG + Intronic
903715099 1:25359448-25359470 ATATTGGAAGAATTGTCTTGAGG + Intronic
908103178 1:60812148-60812170 GAAGTGTAAGAGATTTATTGAGG + Intergenic
908716393 1:67074692-67074714 ATATTGTAATAGGTGTGTAGTGG - Intergenic
908717839 1:67088882-67088904 ACATTGGAAGATATGTGTTGGGG + Intergenic
908956888 1:69642866-69642888 TGATTGGAAGAGATTTATTGTGG + Intronic
908963150 1:69726462-69726484 ATAGTGTAAAGGATGGATTGAGG + Intronic
909258945 1:73462014-73462036 AGATTGTAAGAAATGTTTTTGGG + Intergenic
909364872 1:74807789-74807811 ATATTGTATGAGATAAAGTGGGG - Intergenic
911739509 1:101371625-101371647 CTATTGAAAGAGATGTAATAGGG - Intergenic
912871345 1:113309996-113310018 ATATTTTGTGTGATGTATTGTGG - Intergenic
914134886 1:144892682-144892704 ATATTGTAATAGAAGTTTTAAGG + Intronic
914372321 1:147038466-147038488 ATATAGCAAGAGATCTATTAAGG - Intergenic
914577190 1:148984378-148984400 ATATAGCAAGAGATCTATTAAGG + Intronic
915418359 1:155759689-155759711 TTATTCTAAGAGTTTTATTGGGG - Intronic
915805679 1:158846783-158846805 ATATTGAAAGACATGTATGTAGG - Intronic
915811196 1:158913037-158913059 ATTTTTTAAGACATGTTTTGTGG - Intergenic
916591816 1:166198606-166198628 ATTTTCTAAGATATGTATTATGG - Intergenic
917032605 1:170710478-170710500 TTATTGTAAAATATGTATTATGG - Intronic
917916317 1:179705951-179705973 ATATTGTAAAAAATGTAATGTGG + Intergenic
918767860 1:188511716-188511738 ATATTTGAAGAGATGTATTCTGG - Intergenic
919556555 1:199062308-199062330 AGAGTGTAAGAAATGTATAGGGG - Intergenic
922518954 1:226229708-226229730 ACATTGTAATAGATGTGCTGTGG + Intergenic
1063358001 10:5420405-5420427 ATGTTGTATAAGATGTATTTGGG + Intronic
1065131596 10:22626492-22626514 ATTATGTAAGAAATGTAGTGTGG - Intronic
1065493828 10:26308994-26309016 ATATTTGAAGAGATTTATTCTGG + Intergenic
1065837426 10:29671374-29671396 ATATCCTAAGAGATGTAGTGTGG - Intronic
1067217208 10:44313106-44313128 ATATTGTAAGTGATGACTTGCGG - Intergenic
1068459462 10:57308269-57308291 AAATTGTAAATGATGTATTTTGG + Intergenic
1068557847 10:58478976-58478998 TTATTGTAATAGATGTAATTTGG - Intergenic
1069193212 10:65516452-65516474 ATGTTGTAAGACTTGTTTTGTGG + Intergenic
1069585696 10:69600004-69600026 ATATTTGAAGAGATTTATTCTGG - Intergenic
1072738046 10:97892244-97892266 CTATTTTAAGAGGTGTATTAGGG - Intronic
1073307304 10:102513454-102513476 ACATCGTAATAGATGTCTTGGGG + Intronic
1074656921 10:115601002-115601024 AGATTGTAAGAAATGCAATGCGG - Intronic
1076069231 10:127473087-127473109 TTTTTGTATGAGATGTAATGAGG + Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079622908 11:22576334-22576356 ATATTATAATTCATGTATTGGGG + Intergenic
1079687197 11:23374118-23374140 ATATTTTAAGACTTGTTTTGTGG - Intergenic
1080332542 11:31155847-31155869 ATACTGTATGAGATATATTGTGG - Intronic
1080607296 11:33874279-33874301 ATTTTTTAAAAGATGTATTTTGG - Intronic
1082689512 11:56282705-56282727 ATATTTGAAGAGATTTATTCAGG + Intergenic
1084929421 11:72542633-72542655 ATTTTTTAAGAGTTGTATTGAGG - Intergenic
1085785955 11:79449641-79449663 ACATTTTAATTGATGTATTGAGG + Intergenic
1086040324 11:82469049-82469071 ATTTTGGAAGAGATATTTTGAGG - Intergenic
1087497889 11:98913775-98913797 ATATTTTAAGACTTGTTTTGTGG + Intergenic
1087681844 11:101227254-101227276 ATATTCTAAGTGATTTATTTTGG - Intergenic
1087710625 11:101545671-101545693 AAATTATAAGAAATGTATTAAGG - Intronic
1087735854 11:101832470-101832492 AGAATGTAAGATATGTATTAGGG - Intronic
1087885995 11:103483292-103483314 ATATGGTAGCAGATGTACTGAGG - Intergenic
1087941660 11:104104471-104104493 ATATTGTAAAAGATATACAGTGG - Intronic
1088420303 11:109637663-109637685 ATGCTGTAAGAGATGGCTTGAGG - Intergenic
1088547622 11:110975982-110976004 ATATTGTCAGTGATCTATGGGGG - Intergenic
1092665153 12:10788231-10788253 ATGTTGTAAGAAATAAATTGAGG - Intergenic
1093420657 12:18970678-18970700 ATACTGTAAGAGAAGGAATGGGG - Intergenic
1093494794 12:19743826-19743848 ATAGTGTGACAGTTGTATTGTGG - Intergenic
1094448051 12:30554223-30554245 ATATTTGAAGACATTTATTGTGG + Intergenic
1094651390 12:32379955-32379977 GTATTGGAAGAAATGTTTTGTGG - Intronic
1097338120 12:58407297-58407319 CCACTGCAAGAGATGTATTGAGG + Intergenic
1097564043 12:61245840-61245862 ATATTTTAAGAAATATTTTGAGG - Intergenic
1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG + Intronic
1098053901 12:66483292-66483314 ATATTTAAAAAAATGTATTGGGG - Intronic
1099122865 12:78713532-78713554 ATATTTTAACAGCTGTATTGAGG - Intergenic
1099701230 12:86084938-86084960 AAATAGTAAGAGAGGTAGTGAGG + Intronic
1099862445 12:88237212-88237234 TTTTTGTAAGACATGTCTTGTGG + Intergenic
1101124346 12:101615505-101615527 ATATTGTACCAGATGTAGTGGGG + Intronic
1102185227 12:110942365-110942387 AACTTGCAAGAGATTTATTGAGG - Intergenic
1103117363 12:118347779-118347801 AGCTTGTGAGAGATTTATTGAGG - Intronic
1103461553 12:121108771-121108793 AATTTGAAAGAGCTGTATTGAGG + Intergenic
1104810130 12:131615398-131615420 ATATTTGAAGAGATGTATTCTGG - Intergenic
1105651471 13:22382908-22382930 CTATACTAAGAGATGTATTATGG + Intergenic
1105748230 13:23397753-23397775 ATATTTGAAGAGATTTATTATGG + Intronic
1106895120 13:34291684-34291706 ATGTTATAAGAGATGTCTGGAGG - Intergenic
1107618450 13:42198024-42198046 AAATATTAAGAGATGTATTAAGG - Intronic
1109549378 13:63873296-63873318 ACATTGAAAGAGAAATATTGTGG - Intergenic
1109961260 13:69635343-69635365 ATTTTGTAAGACTTGTTTTGTGG + Intergenic
1110062025 13:71053916-71053938 ATATTCTGAGATATGTTTTGTGG + Intergenic
1110150936 13:72252168-72252190 CTATTGTAAGAGAAGTGTAGAGG - Intergenic
1110627429 13:77667166-77667188 ATATTTTCATAGATGTATTTTGG - Intergenic
1110725587 13:78819093-78819115 ACATTATAAGAGAAGTATTTTGG - Intergenic
1110901668 13:80832596-80832618 ATATTTTAAGACTTGTTTTGTGG - Intergenic
1111037800 13:82702256-82702278 ATTTTGTAATAGGTTTATTGAGG + Intergenic
1111414891 13:87927198-87927220 TTATTTTAAAAAATGTATTGGGG + Intergenic
1112185864 13:97127200-97127222 ATGTTGGAAGAGATTTATTCTGG + Intergenic
1112945922 13:104926870-104926892 ATATTCTAATAGATGTGTAGTGG + Intergenic
1114388703 14:22282843-22282865 ATAGTGAAGGAGATGTATTGGGG - Intergenic
1115865202 14:37739178-37739200 ATAGTTTAAGAAATATATTGTGG + Intronic
1116258967 14:42597573-42597595 ATATTGAATGAGATGAACTGGGG - Intergenic
1116302999 14:43209800-43209822 TTATTCTAATAGGTGTATTGTGG - Intergenic
1116757001 14:48960701-48960723 TTGTTGTAAGAGAAGGATTGAGG - Intergenic
1117075467 14:52098967-52098989 CTATTGTCAGAGATAAATTGTGG - Intergenic
1117229675 14:53703158-53703180 AAAGTGTAAGAGATTTATTTAGG + Intergenic
1119893270 14:78199068-78199090 ACATTGTCAGAGCTGCATTGTGG + Intergenic
1120399692 14:84014353-84014375 ATGTAGTAAGAGATTAATTGTGG - Intergenic
1120556195 14:85931894-85931916 AAATTGTAAGTAATGTAGTGGGG + Intergenic
1120834074 14:89025129-89025151 ATATGGAATGTGATGTATTGTGG + Intergenic
1123663449 15:22586736-22586758 ATATTGTAGAACATGTATTAAGG - Intergenic
1123888898 15:24755992-24756014 ATATTTGAAGAGATTTATTCTGG + Intergenic
1124157602 15:27240554-27240576 ATATTGTAAATGATTTATTTTGG - Intronic
1124317279 15:28681168-28681190 ATATTGTAGAACATGTATTAAGG - Intergenic
1124566165 15:30816307-30816329 ATATTGTAGAACATGTATTAAGG + Intergenic
1128921269 15:71612250-71612272 CTTTTGTAAAAGATGTAATGAGG + Intronic
1136157847 16:28396726-28396748 ATTTTGTAATAGCTTTATTGAGG - Intronic
1136205240 16:28718557-28718579 ATTTTGTAATAGCTTTATTGAGG + Intronic
1136870865 16:33807011-33807033 TTATTGTAAGTGAGGTATTAAGG + Intergenic
1138165448 16:54797240-54797262 ATATAGAAAGAGATTTATTGTGG + Intergenic
1138896825 16:61215917-61215939 ATATTCCAAGAGAACTATTGCGG - Intergenic
1139031060 16:62881356-62881378 ATATTGAAAGAGATATAATTTGG - Intergenic
1140630236 16:76843598-76843620 ATATTGTCAGTGGAGTATTGAGG + Intergenic
1203101307 16_KI270728v1_random:1309047-1309069 TTATTGTAAGTGAGGTATTAAGG - Intergenic
1143513898 17:7409873-7409895 ATAGTTTCAGAGATGTACTGGGG - Intronic
1144151033 17:12446435-12446457 CCATTCTAAGAGATGTGTTGTGG + Intergenic
1144785064 17:17826952-17826974 ATATTGTCAGAGATGGATCTGGG - Intronic
1146187469 17:30733756-30733778 ATTGTGTAAAAAATGTATTGAGG + Intergenic
1146326888 17:31893968-31893990 ATATTATATGAGAAGTATTTTGG - Intronic
1146332525 17:31939151-31939173 ATTGTGTAAAAAATGTATTGAGG + Intronic
1147032520 17:37651243-37651265 ATATTTAAGGAGATCTATTGCGG + Intergenic
1149698589 17:58636624-58636646 ATATTGTGAAATATGTATTTGGG + Intronic
1149965639 17:61161323-61161345 ATATTGTTAAAGAGGTATTCTGG + Intronic
1149974275 17:61250396-61250418 ATATTGTACGAGATGGAAAGAGG + Intronic
1153374955 18:4365568-4365590 ATATTTTAATAGTTTTATTGAGG - Intronic
1155372553 18:25117374-25117396 ACATTGTAAGTGTTGTGTTGTGG - Intronic
1155569835 18:27180894-27180916 ATATTTTAAAAGAAATATTGTGG - Intronic
1156002860 18:32405170-32405192 AAATTGTAAGAGAAGTACAGTGG - Intronic
1157131518 18:45012127-45012149 ATATGGTAAGAGATGCACTATGG + Intronic
1157850670 18:51046925-51046947 AAATTGTTAGACATGTATTCAGG - Exonic
1159183628 18:64943133-64943155 ATAGTGGACGAGATGTAGTGGGG + Intergenic
1162002480 19:7755275-7755297 ATTTTGTAAAAAATGTGTTGTGG + Intergenic
1166517646 19:43459496-43459518 ATATTGCAATACATGTATAGAGG - Intergenic
1166625362 19:44347336-44347358 ATATTTTAATTGATGTATTCAGG + Intronic
1168437137 19:56327614-56327636 ATATTGTAAAATATGCATTTTGG - Intronic
925765206 2:7227081-7227103 ACATTGTTTGAGATGTATTAAGG + Intergenic
927271136 2:21212008-21212030 ATTTTGGAATAGATGTGTTGTGG + Intergenic
928994118 2:37268549-37268571 ATATTGTGAGAGAAGTATGTTGG + Intronic
929286138 2:40137256-40137278 ATATTGGATAAGAGGTATTGGGG + Intronic
929674247 2:43909086-43909108 ATATTTCAAGAGATATTTTGTGG - Intronic
929691474 2:44078121-44078143 AGATTGTAAGAGGTGGAATGAGG + Intergenic
929702900 2:44180037-44180059 ATATTTTAAGAGTTGACTTGAGG - Intronic
930404381 2:50936434-50936456 ATACTGTCAGAAATGTATTAAGG - Intronic
930935592 2:56947169-56947191 ATATTGTAATATTTGTATTGTGG - Intergenic
931113236 2:59135987-59136009 AGTTTGTAATAGATGTGTTGGGG + Intergenic
931291238 2:60875806-60875828 ACAGTGCAAGAGATTTATTGGGG - Intergenic
931440972 2:62290245-62290267 ATATTGTAAAATATATATTTGGG + Intergenic
931852907 2:66271006-66271028 ATTTTGGAACAGATGTACTGAGG - Intergenic
932580013 2:72987089-72987111 ATATAGTAATAGATGTTTTTTGG + Intronic
933026499 2:77266503-77266525 ATATTTTAACTGATGTTTTGGGG + Intronic
933113568 2:78436353-78436375 ATTTAGTAAGATATGTATTAGGG - Intergenic
933431357 2:82183874-82183896 ATATTGTAAGAGAGCGAATGAGG - Intergenic
935156687 2:100489263-100489285 TTCTTGGAAGAGATGTTTTGAGG + Intergenic
935511711 2:103984148-103984170 ATATAGAAGGAGATTTATTGTGG - Intergenic
936931372 2:117792787-117792809 ATATAGTAAGAAGTGTGTTGAGG - Intergenic
937085960 2:119171996-119172018 ATATATTAAGAGTTGTGTTGCGG + Intergenic
937628512 2:124070948-124070970 ATATCTTAAGACTTGTATTGAGG - Intronic
939195994 2:138973310-138973332 ATATTCTAAGAGATGTAAAAGGG - Intergenic
939702701 2:145413460-145413482 ATGTTGTAAGAGGTCTATGGAGG - Intergenic
941123194 2:161555159-161555181 ATATTTTTAAAGATATATTGTGG - Intronic
944150013 2:196547901-196547923 ATATTGTAAGACATCACTTGGGG + Intronic
944362553 2:198875327-198875349 AAATTGTAAGAGGTGAATTTTGG - Intergenic
946209239 2:218134110-218134132 TTATTTTAAAAGATGTATTCTGG - Intronic
946888668 2:224251398-224251420 AAATTGTTAGAGATGTATTATGG + Intergenic
1168823081 20:789963-789985 ATATTTGAAGAGATTTATTTTGG + Intergenic
1169476959 20:5940245-5940267 GAAGTGTAAGAGATTTATTGAGG - Intronic
1170055850 20:12201664-12201686 ATTTTGCAAGTGATTTATTGAGG - Intergenic
1173056093 20:39614317-39614339 ATAGTGTGAAAGATGTATTGGGG - Intergenic
1173066669 20:39719823-39719845 ATATTGTTCCAGATGTATTTTGG + Intergenic
1173441754 20:43083716-43083738 ATATTCTAAAAACTGTATTGTGG - Intronic
1176979188 21:15359845-15359867 ATATTGTAAGAGATTTGTGGTGG - Intergenic
1177096219 21:16837010-16837032 AGAGTGTCAGAGATGTAATGGGG - Intergenic
1178473296 21:32914331-32914353 ATAATGGAAGACATTTATTGAGG + Intergenic
1180905281 22:19406125-19406147 ATATTGTATGTGATGTCCTGTGG - Intronic
1181999747 22:26910760-26910782 AAACTGTAAGAGAGGGATTGAGG + Intergenic
1182313707 22:29427701-29427723 AGATTGTAAGAGCTGGACTGGGG + Intergenic
1184933220 22:47697422-47697444 ATATTTAAAGAGATTTATTTTGG + Intergenic
950193781 3:10994928-10994950 TTATTCTAAGAGGTTTATTGAGG - Intronic
952793070 3:37215784-37215806 ATAATTTAAGAAATGTATTCTGG + Intergenic
953682287 3:45048663-45048685 GAAGTGTAAGAGATGTTTTGGGG - Intergenic
954596849 3:51832146-51832168 ATATTGTCAGAACTGAATTGAGG + Intergenic
955152985 3:56387282-56387304 ATTTTGTAACAGAGGTTTTGGGG - Intronic
955185261 3:56709166-56709188 ATATTTAAATAGATTTATTGTGG - Intergenic
957161253 3:76612145-76612167 ATTTTGTAAGACATGTTTTGTGG + Intronic
957318959 3:78604778-78604800 GTATTTTAATAGATATATTGTGG - Intronic
958644311 3:96850117-96850139 CTATTGTAAGTGATTTATTTTGG + Intronic
958856818 3:99395268-99395290 AAATTGGAAGAGATTTTTTGGGG - Intergenic
959354026 3:105303092-105303114 ATATAGGAAGAGATTTATTAGGG + Intergenic
962563363 3:136631861-136631883 ATATTTGAAGAGATATAATGGGG + Intronic
962668127 3:137677042-137677064 ATATTTTAAGACTTGTTTTGTGG - Intergenic
964398136 3:156269378-156269400 ATATTTTAAGACTTGTCTTGTGG + Intronic
964559215 3:157975256-157975278 ATATTTTAACAGCTCTATTGAGG - Intergenic
965810247 3:172584342-172584364 AAACTTTAAGAGATGTATTCCGG + Intergenic
968862045 4:3180374-3180396 TTATGGTAAGAGATGAATTAAGG - Intronic
969126265 4:4950645-4950667 ATCTTGTAAGAAATGTTTTAGGG + Intergenic
969316511 4:6384485-6384507 ATTTTTTAATAGCTGTATTGAGG + Intronic
969894297 4:10288729-10288751 GTATTGTAAGAGGTGTACAGTGG + Intergenic
971101216 4:23467887-23467909 AAATTGTCAGTGATGTAGTGAGG + Intergenic
972068510 4:34983585-34983607 CAATTGTCTGAGATGTATTGAGG + Intergenic
972434250 4:39016758-39016780 AGATTGTTTGAAATGTATTGAGG + Intronic
972841708 4:42938150-42938172 ATATTGTAACTCATTTATTGGGG - Intronic
973809129 4:54553143-54553165 TTATTGGAAGAGAGGGATTGAGG + Intergenic
973889818 4:55357625-55357647 ATAGTTTAAGAGATGTTGTGTGG + Intronic
973904026 4:55508489-55508511 ATGGTTTAAGAGATGAATTGGGG - Intronic
974134577 4:57799017-57799039 ATATGGTAAGCCATGTTTTGTGG - Intergenic
974288674 4:59902998-59903020 ATATATTCAGAGTTGTATTGAGG - Intergenic
974315393 4:60272696-60272718 AAATTATAAAAGATGTTTTGGGG - Intergenic
974430110 4:61785710-61785732 ACATTATCAGAGATGTATTCTGG + Intronic
975188942 4:71437337-71437359 ATATTGTAACTTATGTATTCTGG - Intronic
977690596 4:99904541-99904563 ATATTTTATGAGATGTCTTGAGG - Intronic
979750722 4:124275538-124275560 ATATTTTAAGTGATATTTTGGGG + Intergenic
980695515 4:136350390-136350412 ATATTGCATCAGAAGTATTGTGG - Intergenic
981865376 4:149411166-149411188 CTATTGAAAGTGAAGTATTGAGG - Intergenic
981886419 4:149678501-149678523 GTATTGTAAGATGGGTATTGTGG - Intergenic
982855887 4:160382369-160382391 ATATTTTAAGAGATGTTATTAGG - Intergenic
983665562 4:170177687-170177709 TTATTGAAAGTGAAGTATTGAGG + Intergenic
983837518 4:172410426-172410448 ATATTTTAAGAGATATTTTTCGG - Intronic
984343822 4:178493892-178493914 ATTTTTTAAGACTTGTATTGTGG - Intergenic
984514019 4:180716111-180716133 TTATTTGAAGAGATGTATTATGG + Intergenic
988018294 5:25589949-25589971 TTTTTGTAAGCAATGTATTGAGG + Intergenic
988702687 5:33691075-33691097 AAACTGTAAGAAATGTTTTGTGG - Intronic
990528471 5:56651398-56651420 ATATGGAAAGAGATTTATTATGG - Intergenic
991408752 5:66326688-66326710 ATATTATAAGAGATTTAATCTGG - Intergenic
991476165 5:67021824-67021846 TTATTTTAAAAAATGTATTGAGG + Intronic
992934776 5:81690816-81690838 ATATTTTAAGACTTGTTTTGTGG - Intronic
992999530 5:82366672-82366694 TTATTGTAAAATATTTATTGAGG + Intronic
993475116 5:88355120-88355142 ACATTGTAAAAGATGGATTGTGG + Intergenic
994070676 5:95598735-95598757 AAATTATAAGAGATGAGTTGGGG - Intronic
994766390 5:103923402-103923424 CAATTAGAAGAGATGTATTGGGG + Intergenic
994812182 5:104534115-104534137 ATATTTTAACATATTTATTGAGG + Intergenic
995337735 5:111021038-111021060 AGATTCTAAGAGATTTATTGAGG + Intergenic
995454544 5:112337745-112337767 ATATTGTAAAAAAAGTACTGGGG + Intronic
996272450 5:121623202-121623224 AAATCTTAAGAGCTGTATTGAGG - Intergenic
997109336 5:131057857-131057879 ATATTTTAAGATTTGTTTTGTGG - Intergenic
998802431 5:145883468-145883490 TTATTGTAAAAGATATATTTTGG + Intergenic
1000468097 5:161605464-161605486 ATATTATAAGGGATTTATTCAGG - Intronic
1000823898 5:166020198-166020220 ATATTTGAAGAGATTTATTCTGG + Intergenic
1002656228 5:180749988-180750010 TTATTTTAAGAGATTTATTGAGG + Intergenic
1004352974 6:14907024-14907046 GAATTGTAAGAGCTGTATTTTGG - Intergenic
1004386379 6:15176492-15176514 ATATTTTAATAGAAGAATTGAGG + Intergenic
1007217955 6:40255656-40255678 ATCTTGTAAGAGAGGCATGGTGG - Intergenic
1007408524 6:41648523-41648545 ATTGTGTAGGAGATGTCTTGGGG - Intronic
1007904190 6:45442890-45442912 ATATGGAAAGAGATGCAGTGGGG - Intronic
1008784569 6:55151282-55151304 ATTTTGAAAGAGTTTTATTGTGG - Intronic
1008955538 6:57212421-57212443 AAAGTGCAAGAGATTTATTGGGG - Intronic
1010567789 6:77438556-77438578 ATTTTTTAAGAGCTGTATTGTGG - Intergenic
1011124934 6:83996976-83996998 AAATTGTAATAGCTTTATTGAGG - Intergenic
1011523071 6:88231606-88231628 ATATTCTAAGACTTGTTTTGTGG - Intergenic
1011633241 6:89347500-89347522 ATATTATGAGAGATGTATAAAGG + Intronic
1011681176 6:89784806-89784828 AAATTTTAAGAGATGTATGCTGG + Intronic
1012870057 6:104661788-104661810 ATGTTGTCAGTGAAGTATTGAGG - Intergenic
1013792080 6:113848811-113848833 CTGTTGTAAGAGAAGTATTTAGG - Intergenic
1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG + Intergenic
1014910408 6:127085838-127085860 ATATAGTAAGATTTGCATTGAGG + Intergenic
1015420388 6:133001296-133001318 ATACTGTAAGAGTCATATTGTGG - Intergenic
1015778881 6:136842871-136842893 ATTTCGTAAGGGATGTAATGGGG + Intronic
1016526444 6:145006779-145006801 ATGTTGGAAGAAAAGTATTGAGG - Intergenic
1017631787 6:156403093-156403115 ATATAGTAACAGACATATTGAGG - Intergenic
1019030346 6:169004708-169004730 ATATTTGAAGAGATTTATTCTGG - Intergenic
1019040022 6:169096019-169096041 TGTTTGTAACAGATGTATTGAGG + Intergenic
1019099692 6:169619402-169619424 ATATTGGAAGAAATTTATTCTGG + Intronic
1020342752 7:7130466-7130488 ATATAGAAAGAGATGTAATAAGG - Intergenic
1020672517 7:11135042-11135064 ATTTTGTAACAGATGCAATGAGG - Intronic
1021391859 7:20102689-20102711 ATATTGAAATAGTTTTATTGAGG + Intergenic
1021395863 7:20147511-20147533 ATATTGTAAATGATGTACTGAGG - Intronic
1021638875 7:22718933-22718955 ATATTGTATGAGCTCTATTTGGG - Intergenic
1022020218 7:26392731-26392753 ATATTACCAGAGATGTCTTGTGG - Intergenic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1023325131 7:39046145-39046167 CTATTGTAATGGATTTATTGTGG + Intronic
1023411694 7:39894494-39894516 ATATTTGAAGAGATTTATTCTGG - Intergenic
1023555931 7:41423054-41423076 ATATTGAGAGAGATCAATTGAGG + Intergenic
1030327500 7:108236253-108236275 ATTTAGTAAAAGATGTCTTGTGG - Intronic
1030475262 7:110024350-110024372 ATATTTTCTGAGATTTATTGTGG + Intergenic
1030629757 7:111883037-111883059 ATATTAAAAGAGAAGTATAGAGG - Intronic
1030635968 7:111949153-111949175 ATATTTTTTGAGATGTAATGAGG + Intronic
1030959438 7:115897610-115897632 ATATTGAAAGTGGAGTATTGAGG + Intergenic
1031443315 7:121820758-121820780 ATATTTTAACAGCTTTATTGAGG - Intergenic
1031802558 7:126266607-126266629 ATTTTTTAAGAGTTGTTTTGTGG - Intergenic
1032277414 7:130471281-130471303 ATATTATAGGAGATATAATGGGG + Intergenic
1032671951 7:134091975-134091997 ATATATAAAGAGATATATTGGGG - Intergenic
1033578623 7:142711243-142711265 AAATTTTAAAAGATGTATTTTGG + Intergenic
1035581561 8:743380-743402 AACTTGTAAGAGATGTTCTGAGG + Intergenic
1035927141 8:3740657-3740679 AGATTTTACGAGATGTATTGGGG + Intronic
1038597442 8:28901492-28901514 ATAATCTAAGAGATGTTATGGGG - Intronic
1038953504 8:32442713-32442735 ATTTAGAAATAGATGTATTGAGG + Intronic
1039638157 8:39188890-39188912 ATAATGTGTGAGATGTACTGTGG - Intronic
1039928821 8:41963642-41963664 ATATTGTCAGCAATGGATTGAGG - Intronic
1040916338 8:52569297-52569319 AAATTGTCAGTGATGTAGTGGGG + Intergenic
1041357597 8:57016793-57016815 ATATTGCAAAAGATGAATTAAGG + Intergenic
1042876307 8:73443483-73443505 ATAGTGTCTGAGATGTAATGTGG + Intronic
1043017294 8:74955431-74955453 ATATTCCAAGTGATGTATTATGG - Intergenic
1043251564 8:78080291-78080313 ATTTTGTCAGAGATGTATATTGG + Intergenic
1043718436 8:83512722-83512744 ATATTTAAAGAGATTTATTCTGG + Intergenic
1043762572 8:84086386-84086408 ATAATGCAAGATATGGATTGAGG - Intergenic
1044121084 8:88396826-88396848 TTATTGTAAGAGACATAATGAGG + Intergenic
1045700981 8:104865871-104865893 ATCTTGGAAGAGGAGTATTGAGG - Intronic
1045868500 8:106897606-106897628 TTATTGTAGTAGATGTATTTTGG - Intergenic
1046076912 8:109323574-109323596 ATAATGTAAGAGTTCTATTTGGG + Intronic
1046120057 8:109834802-109834824 GTTTTGTAATAGATTTATTGAGG - Intergenic
1046595444 8:116255963-116255985 ATATAGGAGGAGATGTATTATGG - Intergenic
1047061055 8:121226501-121226523 ATATTCTATGATATGTATTAGGG - Intergenic
1047268790 8:123334678-123334700 ATTTTGCAAGAGATTTATAGAGG + Intronic
1047822452 8:128536118-128536140 ATAGTGCAAGAGATCTCTTGAGG - Intergenic
1049870279 8:144969671-144969693 ATATTTGAAGAGATTTATTCTGG - Intergenic
1050808428 9:9714052-9714074 ATCTTGTAAAAGATGTACTGGGG - Intronic
1050906210 9:11010096-11010118 ATATTTTAAGACTTGTTTTGTGG + Intergenic
1050991201 9:12154599-12154621 ATATTGTTAGAAATGTATCATGG - Intergenic
1050994607 9:12200404-12200426 TTATTGTAAGACATATTTTGAGG + Intergenic
1051899057 9:22018832-22018854 ATAGTGTATGATATTTATTGGGG - Intronic
1052441902 9:28508630-28508652 ATAAAGGAAAAGATGTATTGTGG - Intronic
1052471141 9:28899126-28899148 AAATTTTAAAAGATGCATTGAGG + Intergenic
1056985005 9:91355118-91355140 ACATTTTAAGAAATGTATTAAGG + Intronic
1058192409 9:101934965-101934987 ATATTCTAAGAGATGAAATAAGG + Intergenic
1058281485 9:103121670-103121692 ATATTTTAACAGCTTTATTGAGG - Intergenic
1059361051 9:113742005-113742027 ATATTGTACAAGAAGCATTGTGG - Intergenic
1186207868 X:7218900-7218922 ATATAATAAGAGATATGTTGTGG + Intergenic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187593823 X:20748371-20748393 ATATTGTAATACATTTATTTTGG + Intergenic
1187600878 X:20828599-20828621 ATGTTGTAATAGAACTATTGAGG - Intergenic
1188254662 X:27946752-27946774 ATACTGTAAGAAATATTTTGAGG + Intergenic
1188998833 X:36920532-36920554 ATTTTGTAAGACTTGTTTTGTGG + Intergenic
1189280708 X:39818674-39818696 TAAGTGTGAGAGATGTATTGGGG + Intergenic
1191167866 X:57410252-57410274 ATTTGGTAAGACATGTATTGTGG + Intronic
1191957091 X:66654782-66654804 ATATTTTAAGACTTGTTTTGTGG - Intergenic
1192217885 X:69176743-69176765 AAAATCTAAGAGATGTTTTGGGG + Intergenic
1192379298 X:70599059-70599081 ATATTTTAACAGACTTATTGAGG - Intronic
1193864409 X:86712684-86712706 ATGTTGTAAGAGTTGTTTTGAGG + Intronic
1196664655 X:118303874-118303896 ATATTGTAAGTGATGTTCAGTGG + Intergenic
1196972095 X:121120801-121120823 ACTTGGTAAGAGATCTATTGTGG - Intergenic
1197482667 X:127006314-127006336 TTCTTGTAAGTCATGTATTGTGG - Intergenic
1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG + Intergenic
1199319842 X:146425375-146425397 TTATTGTAAGAGATGGGTTTGGG + Intergenic
1199466579 X:148144777-148144799 ATTTTATAACAGATGTTTTGAGG + Intergenic
1200810255 Y:7477244-7477266 ATTTTGGAAGAAATGTAATGTGG + Intergenic
1200860841 Y:7990331-7990353 ATTTTGTAAGTAATGTCTTGTGG - Intergenic
1200973252 Y:9179025-9179047 ATATTGTCAGTAATGTAGTGGGG + Intergenic
1202057922 Y:20855178-20855200 ATTTTGTAATAGGTGTAGTGTGG + Intergenic