ID: 1097614655

View in Genome Browser
Species Human (GRCh38)
Location 12:61869626-61869648
Sequence TGTGCTCTGTTACACTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097614655_1097614657 -9 Left 1097614655 12:61869626-61869648 CCTCCACAGTGTAACAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 178
Right 1097614657 12:61869640-61869662 CAGAGCACACTAGTGTCCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097614655 Original CRISPR TGTGCTCTGTTACACTGTGG AGG (reversed) Intronic
903168804 1:21539598-21539620 TGTGCTGTGTGACACTGGGGAGG + Intronic
904242948 1:29162015-29162037 TGTGCTAGGTTACAATGTGTAGG + Intronic
906898937 1:49811954-49811976 TGTGGCATGTAACACTGTGGAGG - Intronic
907606456 1:55822600-55822622 GCTGCCCTGTTACACTGGGGTGG + Intergenic
908494938 1:64685423-64685445 TGTACCCTTGTACACTGTGGAGG + Intronic
908746648 1:67382945-67382967 TGTTCTCTGCTACACTGCTGTGG + Intronic
909271173 1:73626053-73626075 TGTGCTCTGTGAAAATGTGTGGG + Intergenic
910900620 1:92116304-92116326 TGTGTTCTGTTGTCCTGTGGTGG + Intronic
919325851 1:196105983-196106005 TGTCCTCTGTTACACTAGTGCGG - Intergenic
920341740 1:205279449-205279471 TGTGCTGTGTGACACTGAGCAGG + Intergenic
921016316 1:211195215-211195237 TGTCCTCTGTCACACTGAGTGGG - Intergenic
922223907 1:223628780-223628802 TGTCCCCTGTGACACTGTGCAGG - Exonic
1064237833 10:13592932-13592954 GGTGCTCTGTTATACTCTAGTGG - Intronic
1066235659 10:33481755-33481777 TGTTCTCTCTTGCACAGTGGTGG + Intergenic
1067024112 10:42828486-42828508 TGTGCTCTGCTTCAGTGTGGAGG + Intronic
1068385526 10:56322046-56322068 TTTGCTCTGTTACGCTGTATAGG - Intergenic
1069380083 10:67834368-67834390 AGTGCACAGTAACACTGTGGGGG + Intronic
1070146257 10:73775610-73775632 TCTGCTCTGTTTCATTGTTGTGG - Exonic
1070527390 10:77306992-77307014 TGTGCTATGTTGCACTGGTGAGG - Intronic
1075337082 10:121616367-121616389 TGTTCTCTGTTAGGATGTGGGGG + Intergenic
1075827954 10:125376540-125376562 GTTGCTCAGTTTCACTGTGGTGG - Intergenic
1077701553 11:4446731-4446753 TGTGGTCTGTCGCACTGTAGTGG + Intergenic
1080896320 11:36451426-36451448 TGTGCTCAGTTAAACAGTGCTGG - Intronic
1081245512 11:40761801-40761823 TGTCTTCTGTTACACTGATGTGG + Intronic
1083278926 11:61613609-61613631 TCTGCACTGTTACACAATGGAGG + Intergenic
1085042738 11:73336109-73336131 TGTGCTCTGTGACCCTGGTGAGG + Intronic
1089572577 11:119420219-119420241 CGTGCTCTTTGGCACTGTGGGGG - Exonic
1089792555 11:120955278-120955300 TGTGCTCTGTCCCTCTGTGTGGG - Intronic
1091196510 11:133735826-133735848 GGTTCTCTATTACTCTGTGGTGG + Intergenic
1092440584 12:8497950-8497972 TGTGCTCTGATACACTCAGGGGG + Intergenic
1092631428 12:10381928-10381950 TTTGCTGTGTTCCAATGTGGTGG - Intronic
1093091071 12:14920940-14920962 TGTACTCTGTCACCATGTGGAGG + Exonic
1095692552 12:45106775-45106797 TGTGGACTGTTAGAGTGTGGAGG - Intergenic
1097614655 12:61869626-61869648 TGTGCTCTGTTACACTGTGGAGG - Intronic
1097733074 12:63151255-63151277 TGTCCTCTGCATCACTGTGGAGG + Intergenic
1098451232 12:70620263-70620285 TGAGCTCTGTAACACAGTGCTGG + Intronic
1099974275 12:89530020-89530042 TGTGCTCTCCTATACTTTGGAGG - Intergenic
1105938145 13:25120814-25120836 AGTGCTATGTTCCACTGTTGTGG - Intergenic
1107568117 13:41627636-41627658 GGTGCACTGTTCCAGTGTGGAGG - Intronic
1109942240 13:69385249-69385271 AGTGCTGTGTTTTACTGTGGTGG - Intergenic
1112569532 13:100581196-100581218 TGTGCTCATTTCGACTGTGGTGG - Intronic
1113533236 13:111044900-111044922 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533247 13:111044942-111044964 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533258 13:111044984-111045006 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533269 13:111045026-111045048 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533280 13:111045068-111045090 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533291 13:111045110-111045132 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533302 13:111045152-111045174 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1113533313 13:111045194-111045216 TGGGCTCTGTTACACTCCCGGGG + Intergenic
1115949481 14:38703816-38703838 TGTGCTATGGTCAACTGTGGAGG - Intergenic
1116584696 14:46687505-46687527 TGTGCTGTGTTCCACTGTGGTGG + Intergenic
1116754966 14:48936397-48936419 TGTGCTCTGTTCCCCTGGGTAGG - Intergenic
1117556282 14:56888410-56888432 TGGGCTTTGTTCCACTGTGTAGG - Intergenic
1118361573 14:65061770-65061792 AGTTCTCTGTAAGACTGTGGTGG + Exonic
1120954883 14:90073157-90073179 TGGTCTCTTTTACAGTGTGGTGG + Intronic
1122136009 14:99633389-99633411 TCTGCTCAGTTCCTCTGTGGGGG - Intergenic
1122422516 14:101586621-101586643 CCAGCTCTGTTACACTGTGCTGG - Intergenic
1122945991 14:105009759-105009781 TTTGCTCTGCAACCCTGTGGGGG + Exonic
1123425262 15:20165526-20165548 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1123534486 15:21172060-21172082 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1124810803 15:32936276-32936298 TGTGCTTTGTTACTTTGTGTTGG + Intronic
1128193200 15:65724481-65724503 TGTGCTATGTTGTTCTGTGGTGG - Intronic
1131099848 15:89679334-89679356 TGGGCTCTGTGAGACTGAGGTGG - Exonic
1131576772 15:93600198-93600220 TGTACTCTGTTTCACTGCGGAGG - Intergenic
1132629357 16:909387-909409 TGTGCTTTGGTGCACTGTGAGGG - Intronic
1135163524 16:20118182-20118204 ACTGCTCTGTTTCTCTGTGGGGG - Intergenic
1136687659 16:32004524-32004546 TTTGCTGTGTTTCACTGTGGTGG + Intergenic
1136788268 16:32948074-32948096 TTTGCTGTGTTTCACTGTGGTGG + Intergenic
1136859596 16:33690217-33690239 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1136881544 16:33905857-33905879 TTTGCTGTGTTTCACTGTGGTGG - Intergenic
1137645542 16:50070341-50070363 TATTCTCTGTTATACTGTGTAGG + Intronic
1138392128 16:56677511-56677533 TGTGCTCTGTGAGACAATGGTGG - Intronic
1141162212 16:81636997-81637019 TGTTTGCTGTTGCACTGTGGGGG + Intronic
1141391752 16:83670533-83670555 TGTGCTGTGCTGCTCTGTGGTGG - Intronic
1142113120 16:88342494-88342516 TCTGCTCTGATGCACGGTGGGGG + Intergenic
1203090470 16_KI270728v1_random:1209589-1209611 TTTGCTGTGTTTCACTGTGGTGG + Intergenic
1203121102 16_KI270728v1_random:1538396-1538418 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1144123398 17:12178717-12178739 TGTCACCTGTTACTCTGTGGCGG - Intergenic
1146153533 17:30498945-30498967 TGTTCTCTGTCTTACTGTGGTGG - Intronic
1146566906 17:33921463-33921485 TATGGTCTGTTACACTGTTTTGG - Intronic
1146769765 17:35557893-35557915 TGTGCACTGTTAAATTCTGGAGG - Exonic
1147148644 17:38500193-38500215 TTTGCTGTGTTTCACTGTGGTGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149320322 17:55475051-55475073 TGTCCTCTTAAACACTGTGGGGG - Intergenic
1149400169 17:56287860-56287882 TTTGCTTTGTTACACAGTGTGGG + Intronic
1150429743 17:65105623-65105645 TGTGCTCTGGTAAACAGTGGTGG + Intergenic
1151759426 17:76092152-76092174 TGTGCTCAGATAGACTGTGGGGG - Intronic
1152606017 17:81290660-81290682 TGTGTTCTGTTTGACTGTGGTGG + Intronic
1155367980 18:25067827-25067849 TGTGCTTTGTAACACTCTGTTGG + Intronic
1155979344 18:32164437-32164459 TGAGATCTGTTCCACTGTGGAGG - Intronic
1156803267 18:41144695-41144717 TGTGATCAGATACACTGTTGTGG + Intergenic
1157226577 18:45871219-45871241 TGTGCACTGATACATTGTTGTGG - Intronic
1158597272 18:58827461-58827483 TGTGAACTGTAACACTGTGAAGG - Intergenic
1158761966 18:60400780-60400802 TCTGGTGTGTTACAGTGTGGTGG + Intergenic
1165853091 19:38862468-38862490 TGTGGTCTGTAACACTGGGCGGG - Intergenic
925218694 2:2120574-2120596 TGTACGCTGGTACACTGTGAGGG + Intronic
926033711 2:9616742-9616764 GGAACTCTCTTACACTGTGGTGG + Intronic
927461017 2:23298227-23298249 TGTGCCATGTTGCACTGTGCTGG - Intergenic
927736654 2:25529541-25529563 TGTGCTATGGAACACTGTGTAGG + Intronic
929601234 2:43206100-43206122 TGTGCTCTGGGACATGGTGGGGG + Intergenic
929849256 2:45568352-45568374 TGTGTTCTGTGATACTGTGCTGG + Intronic
930335293 2:50038189-50038211 TCTACTCTGTGACATTGTGGTGG + Intronic
932946528 2:76238928-76238950 GGTGCTGTGTTCTACTGTGGTGG + Intergenic
933487669 2:82944105-82944127 TGTACTCTTTTACAGTTTGGTGG - Intergenic
933561511 2:83892727-83892749 TTTGCTCTGTTAAACTGTCCCGG + Intergenic
934457958 2:94191327-94191349 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
935671697 2:105561762-105561784 TCTCCTCTCTTACACTGTGGAGG + Intergenic
936384728 2:112019090-112019112 TGTGCTCTGTCCCACTCTGAAGG + Intronic
938111589 2:128570483-128570505 AGGGCTCTGCTACACTATGGTGG - Intergenic
940830499 2:158459584-158459606 TGTGTCCAGTAACACTGTGGAGG + Intronic
941140074 2:161769062-161769084 ACTGCTTTGTTACACTGTAGAGG - Intronic
941674467 2:168328929-168328951 TGTGCTCTGGCACAGTGTGTTGG - Intergenic
942112407 2:172695277-172695299 TGTGCTCTATCACACTGTAAGGG + Intergenic
945446612 2:209945896-209945918 TAAGCTCTGTGTCACTGTGGTGG + Exonic
1170058327 20:12231862-12231884 AATGCTCTTTTATACTGTGGTGG + Intergenic
1173949621 20:46979679-46979701 TGAGCTCTGCTGCACTTTGGTGG - Intronic
1177599065 21:23287633-23287655 TGTAATCTATTACACTGAGGGGG + Intergenic
1179365253 21:40753028-40753050 TGAACTCTGTTACATGGTGGAGG - Intronic
1179824285 21:43955314-43955336 TGTTCCCTGTTGCAGTGTGGTGG + Intronic
1182107371 22:27698939-27698961 TCTGCTCTGTTACCACGTGGAGG + Intergenic
1182271808 22:29158525-29158547 TGGGCTCTGTGTGACTGTGGAGG - Intronic
1182792589 22:32965472-32965494 AGTGCTATGGTAGACTGTGGTGG - Intronic
1184296785 22:43530102-43530124 TCTGATCTGTGACTCTGTGGAGG + Intronic
1185195115 22:49464524-49464546 TGGCCCCTGTGACACTGTGGCGG - Intronic
951596042 3:24319134-24319156 TGAACTCTCTTACACTGTTGGGG + Intronic
952683671 3:36124463-36124485 GGTGCTCTGTTTTCCTGTGGTGG + Intergenic
958022414 3:88013812-88013834 TGAACTTTGTCACACTGTGGTGG + Intergenic
961753380 3:129111147-129111169 TGTGTTCTGTTAAAATGTGGAGG + Intronic
964028716 3:152110624-152110646 TGGGCTCTGATACACTGTGCAGG - Intergenic
967662657 3:192132109-192132131 TCTGCTCTGTTGCACTGCAGTGG - Intergenic
967921716 3:194619063-194619085 TGTCCTCTGTAACATGGTGGTGG - Intronic
969660538 4:8524986-8525008 TGTGCTGTGTCACCCTGTAGGGG - Intergenic
970428337 4:15965389-15965411 TGTTCCCTGCAACACTGTGGTGG - Intronic
971261766 4:25063715-25063737 TGTGCTCTGCTAAAATTTGGTGG - Intergenic
973088158 4:46095308-46095330 TTTGTTCTGTTACATTGTTGTGG - Intronic
973941665 4:55917113-55917135 TGTGCTTTCTTACAGCGTGGTGG + Intergenic
974003307 4:56531711-56531733 TCTGCTCTGTTACCTTGTGAAGG - Intronic
974603883 4:64123245-64123267 GGTGCTCAGTAACACTGTGTAGG + Intergenic
976020856 4:80623740-80623762 TATGCTGGGTTACACTGTGTTGG - Intronic
978028823 4:103912668-103912690 TGGTCTCTGTTACTCTGTGTTGG + Intergenic
980083096 4:128364834-128364856 TGAGCTTTGTTACACTGTCAGGG - Intergenic
982839979 4:160172445-160172467 GGTTCGCTTTTACACTGTGGTGG + Intergenic
982932694 4:161428891-161428913 GGTACTCTGCTCCACTGTGGCGG - Intronic
985319442 4:188693314-188693336 TGTGCCCTGGTACACTGAAGGGG + Intergenic
985482067 5:119508-119530 TGTGTCCAGTTACAATGTGGAGG + Intergenic
988461687 5:31444479-31444501 TTTGCTCTGTTACAAAGTAGTGG - Intronic
992775993 5:80089895-80089917 TGTGGTCTGTTAGAGTATGGGGG - Intergenic
992778139 5:80105822-80105844 TGTGAGTTGTTACACAGTGGAGG - Intergenic
994321646 5:98401623-98401645 TTGGCTCTGACACACTGTGGTGG + Intergenic
995929735 5:117425323-117425345 TGTCCTCTGTTAGTCAGTGGGGG + Intergenic
998062649 5:139131493-139131515 TGTGCTTTTTTGCACAGTGGCGG - Intronic
1000436572 5:161217892-161217914 TGTGCTCTTTGACATTGTGCTGG - Intergenic
1000738412 5:164934046-164934068 GGTGCTCTGTTCCAGAGTGGTGG + Intergenic
1007155027 6:39734312-39734334 TGTGCTCTGTAACAGTCTTGTGG - Intergenic
1007424935 6:41740679-41740701 GGAGCTCTGTTTCCCTGTGGAGG - Intronic
1007545559 6:42691092-42691114 TTTCCTCTGTGACACTGTGTTGG - Exonic
1011547537 6:88497982-88498004 TTTGCTTTGTTACACTTTTGTGG + Intergenic
1012546734 6:100427820-100427842 TGTTCTGTCTTACAGTGTGGTGG + Intronic
1014345267 6:120262466-120262488 TCTGCTGTCTTAGACTGTGGGGG + Intergenic
1014754429 6:125287869-125287891 TGTGCTGCCTGACACTGTGGCGG - Intronic
1016473913 6:144405545-144405567 TGTCCTTTGGTACATTGTGGTGG + Intronic
1016722552 6:147319066-147319088 TTTGGTCTGTTACCCTGTGAGGG - Intronic
1021161277 7:17275905-17275927 TGTGCTCTGTTACAAAAGGGTGG + Intergenic
1022468504 7:30667054-30667076 TGTGCTTAGTGACACTGTAGGGG - Intronic
1022712759 7:32867136-32867158 TGTGCTGTGCTACACTGCAGGGG + Intergenic
1022952841 7:35355136-35355158 TGTGTTATGTTACATTATGGTGG - Intergenic
1023104636 7:36751437-36751459 TCTTCTCTGTGAGACTGTGGAGG + Intergenic
1024788498 7:52935150-52935172 TGTGTTATATTACACTATGGAGG + Intergenic
1026003739 7:66583792-66583814 TGTGGTTTGTTACAGTGAGGGGG - Intergenic
1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG + Intronic
1027361868 7:77417057-77417079 AGTGCTCTGTTAGACCCTGGTGG - Intergenic
1030133029 7:106219294-106219316 TGTGCACTGATAGACTGGGGAGG - Intergenic
1030317781 7:108133800-108133822 TGTGGGCTGTTACAGTGAGGTGG - Intergenic
1031466614 7:122120016-122120038 TGTACTCTTTTACAATGTGTCGG + Intronic
1032008522 7:128324687-128324709 TGTGATCTGTTACAGGCTGGTGG - Exonic
1032604020 7:133330039-133330061 GGTGCTCTGTTACAGGGAGGTGG + Intronic
1035753192 8:2009808-2009830 GGTGCCCTGATACCCTGTGGGGG - Intergenic
1037386413 8:18347485-18347507 GGTGCTATGTTCCACTGTGATGG - Intergenic
1040881053 8:52205117-52205139 TATGCTTTATTACACTGTGTTGG + Intronic
1041463726 8:58138579-58138601 GGTGCTCAGTTACACAATGGTGG - Intronic
1043666449 8:82820954-82820976 TGGGCTGTGTTCCACTGTGGGGG + Intergenic
1044513633 8:93112947-93112969 TGTGCTGTGGTGCATTGTGGAGG - Intergenic
1045185530 8:99833586-99833608 TGTCATCTTTTACACTGTAGAGG + Intronic
1046695651 8:117336342-117336364 TTTGCTTTGTTTCACTCTGGAGG + Intergenic
1046903570 8:119547990-119548012 TGTGCTCAGCTAAACAGTGGAGG - Intergenic
1047105404 8:121725813-121725835 TTGGCTCTGTTACAGTTTGGAGG + Intergenic
1047298679 8:123593793-123593815 TGTGATCTCTTCCACTGGGGTGG - Intergenic
1049536358 8:143184220-143184242 TGTGGTCTGTTGCACTGCAGAGG + Intergenic
1050566937 9:6894795-6894817 TGTGAAGTGTTGCACTGTGGTGG + Intronic
1051905298 9:22088113-22088135 TGTGCTCTGTTTCCCCTTGGAGG + Intergenic
1053688466 9:40567132-40567154 TGTGTTCTGCTTCAGTGTGGAGG - Intergenic
1054275564 9:63063926-63063948 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1054299707 9:63368043-63368065 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054399269 9:64701005-64701027 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054432848 9:65185270-65185292 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054497537 9:65836405-65836427 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1056945006 9:90987005-90987027 TGTGCTCTGTGATCTTGTGGAGG - Intergenic
1058242805 9:102587419-102587441 TGGGCTTTCTCACACTGTGGAGG + Intergenic
1059472156 9:114513811-114513833 TGTGGTTTGGTACGCTGTGGTGG - Intergenic
1190122281 X:47672121-47672143 AGTGCTCTATTCTACTGTGGTGG + Intergenic
1190643467 X:52503144-52503166 TGGGGGCTGTCACACTGTGGTGG + Intergenic
1190955422 X:55188301-55188323 TGGGGGCTGTCACACTGTGGTGG - Intronic
1191831345 X:65419638-65419660 GGTGCTGTGTTTCACTGTGGTGG - Intronic
1192812203 X:74557180-74557202 TGTGCTCTGTGAATCTTTGGAGG + Intergenic
1194104912 X:89757063-89757085 TCTGCTCTTTAACACTGTTGTGG - Intergenic
1195890890 X:109693756-109693778 AGTACTCTGTGACACTTTGGAGG - Intronic
1196690186 X:118550687-118550709 AGTGCTCTGTTACAGGGTGGGGG + Intronic
1197458489 X:126708180-126708202 TGTGTTCTCTTACATTCTGGAGG - Intergenic
1200456878 Y:3404852-3404874 TCTGCTCTTTAACACTGTTGTGG - Intergenic