ID: 1097615571

View in Genome Browser
Species Human (GRCh38)
Location 12:61880368-61880390
Sequence CAGCTCCAACAGCTTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097615571_1097615581 11 Left 1097615571 12:61880368-61880390 CCAACACCAAGCTGTTGGAGCTG 0: 1
1: 0
2: 5
3: 35
4: 217
Right 1097615581 12:61880402-61880424 GCAGTGGGCCAAGCAGGACATGG 0: 2
1: 17
2: 25
3: 36
4: 346
1097615571_1097615575 -5 Left 1097615571 12:61880368-61880390 CCAACACCAAGCTGTTGGAGCTG 0: 1
1: 0
2: 5
3: 35
4: 217
Right 1097615575 12:61880386-61880408 AGCTGGAGGCCGCCCTGCAGTGG 0: 12
1: 14
2: 7
3: 33
4: 301
1097615571_1097615576 -4 Left 1097615571 12:61880368-61880390 CCAACACCAAGCTGTTGGAGCTG 0: 1
1: 0
2: 5
3: 35
4: 217
Right 1097615576 12:61880387-61880409 GCTGGAGGCCGCCCTGCAGTGGG 0: 1
1: 16
2: 21
3: 44
4: 230
1097615571_1097615578 5 Left 1097615571 12:61880368-61880390 CCAACACCAAGCTGTTGGAGCTG 0: 1
1: 0
2: 5
3: 35
4: 217
Right 1097615578 12:61880396-61880418 CGCCCTGCAGTGGGCCAAGCAGG 0: 2
1: 10
2: 18
3: 31
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097615571 Original CRISPR CAGCTCCAACAGCTTGGTGT TGG (reversed) Intronic
900125228 1:1066067-1066089 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
901355775 1:8647109-8647131 CACATCCAACAGCAAGGTGTTGG - Intronic
901820884 1:11828660-11828682 CGGCTCCCTGAGCTTGGTGTGGG + Intronic
901834168 1:11912951-11912973 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
901953631 1:12768910-12768932 CAGCTCCCAGAGCCTGGGGTTGG - Intergenic
902303708 1:15521326-15521348 CTGCTCCACCAGCTTCTTGTGGG + Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
904751566 1:32743732-32743754 CTGCTCCAACAGCCTGGGTTTGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907488708 1:54795065-54795087 CACCACCCACAGCTGGGTGTGGG - Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
911155810 1:94635688-94635710 CAGTTCCAAATGATTGGTGTTGG - Intergenic
915401180 1:155623053-155623075 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916525681 1:165606837-165606859 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
917520448 1:175743833-175743855 CAGCTCCAAGAGTTGGGTGCGGG - Intergenic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
922603066 1:226871286-226871308 CAGCTCCAAAAGCTTGCTTCTGG - Exonic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
924876011 1:248105348-248105370 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064594977 10:16934818-16934840 CAGCTCCAACAGCCTGAGTTAGG + Intronic
1067454605 10:46409446-46409468 CAGCACCAATAGATTGGTGGTGG - Intergenic
1067632597 10:47975193-47975215 CAGCACCAATAGATTGGTGGTGG + Intergenic
1068429329 10:56911664-56911686 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1070892881 10:79955156-79955178 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1073309846 10:102532546-102532568 CAGCTCCCTCAGGTTTGTGTTGG + Intronic
1075094000 10:119459252-119459274 GAGCTTCAACAGCTGGGTGGTGG - Intronic
1077005659 11:354699-354721 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1077013367 11:389517-389539 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1077052538 11:574072-574094 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1077249050 11:1552606-1552628 CAGCTCCAGCAGGTGGGTGACGG - Intergenic
1077342866 11:2033719-2033741 CAGCACCAGCAGGGTGGTGTGGG + Intergenic
1077479096 11:2804766-2804788 CAGCTCCAGACGCTGGGTGTGGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078408809 11:11094571-11094593 CAACTCCCACACCTTGGTCTTGG - Intergenic
1079906885 11:26259871-26259893 CAACTCCAATAGTATGGTGTTGG + Intergenic
1081747027 11:45480629-45480651 CAGCTCCAACTGCTGTCTGTGGG + Intergenic
1082862082 11:57866571-57866593 CACCTCCTACTGCTTGGTCTTGG - Intergenic
1084440917 11:69172725-69172747 CAGCCCCAGCAGGTTGGTGTGGG - Intergenic
1085117938 11:73946869-73946891 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1085307453 11:75496075-75496097 CAGCTCCAACAGCATCTTGCAGG + Intronic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1202825852 11_KI270721v1_random:88908-88930 CAGCACCAGCAGGGTGGTGTGGG + Intergenic
1091722558 12:2823984-2824006 CAGCTCCTGCAGCATGCTGTGGG - Intronic
1093337287 12:17921392-17921414 CCCCTCCTACAGCTGGGTGTTGG - Intergenic
1094108742 12:26839147-26839169 CAGCTCCCTCTGCTTGCTGTGGG + Intergenic
1094639360 12:32258945-32258967 CTGCTCCACCAGCTTCTTGTGGG - Intronic
1095115216 12:38344530-38344552 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097149743 12:56967934-56967956 CATCTCCCACAGCTTGGAGGGGG + Intergenic
1097243046 12:57589405-57589427 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1098609576 12:72438850-72438872 ATGCTCCAACACCTTGGTCTAGG - Intronic
1098625450 12:72660371-72660393 CTGCTCCACCAGCTTCTTGTGGG - Intronic
1099635606 12:85206976-85206998 GAGCTCCAAGGGTTTGGTGTGGG - Intronic
1101327712 12:103731128-103731150 CAGCCAGAACAGCCTGGTGTTGG - Intronic
1101522309 12:105495324-105495346 TAGCTCAAACAGCTGGGTGTTGG + Intergenic
1101752148 12:107590579-107590601 CAGTTCCAACAGGCTGGTGTGGG + Intronic
1104795850 12:131516936-131516958 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1104885140 12:132102959-132102981 CTGCTCCACCAGCTTCCTGTGGG + Intronic
1104913766 12:132253290-132253312 CTGCTCCACCAGCTTCCTGTGGG - Intronic
1105015619 12:132785166-132785188 CAGCTGCAACAGCGTGGCGAGGG + Intronic
1105380276 13:19880715-19880737 CAATTCCAACAGCTGGGTGCGGG - Intergenic
1105665476 13:22551567-22551589 TAGCCCCCACAGCCTGGTGTTGG - Intergenic
1110802353 13:79713654-79713676 CAGCTCCAAAAGCTTAGAATAGG - Intergenic
1112014113 13:95317252-95317274 CTGCTCCACCAGCTTCCTGTGGG + Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1112554794 13:100456893-100456915 CTGCTCCACCAGCTTCTTGTGGG - Intronic
1112780734 13:102898008-102898030 CAGCTCCAGCAGCTGGGGTTAGG + Intergenic
1112829238 13:103428234-103428256 GAGCTCCAAAAGCTGGGTGCTGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116561471 14:46384787-46384809 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122983846 14:105203316-105203338 CAGCCCCCACAGCTGGGTGATGG - Intergenic
1124545752 15:30625517-30625539 CAGCTGCAGAAGCTTGGTGTTGG - Intronic
1124779271 15:32614903-32614925 CAGCTGCAGAAGCTTGGTGTTGG - Intergenic
1125785809 15:42316705-42316727 CTGCTCCACCAGCTTCCTGTGGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128785907 15:70397027-70397049 CAGCTCCAACAGCTTTTGTTGGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129468067 15:75735033-75735055 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1129865294 15:78902805-78902827 CTGCTCCACCAGCTTCCTGTGGG - Intergenic
1130011495 15:80156054-80156076 CTGCTCCACCAGCTTCCTGTAGG - Intronic
1130207651 15:81892532-81892554 CAGCTCCCACAGGTCAGTGTGGG - Intergenic
1131271221 15:90948730-90948752 CAGCTCCACCATCTTGGGGTCGG - Exonic
1131971513 15:97898235-97898257 CAGCTCCCACCTCTTGTTGTGGG - Intergenic
1133890743 16:9876567-9876589 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1136711772 16:32243358-32243380 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1136756144 16:32686049-32686071 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1136811969 16:33184324-33184346 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1136818445 16:33294404-33294426 CTGCTCCACCAGCTTCTTGTGGG + Intronic
1136825009 16:33350937-33350959 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1136830075 16:33449708-33449730 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1138654001 16:58480059-58480081 CACCTCCTACAGGTTGGTCTGGG - Intronic
1140026561 16:71296066-71296088 CAACTCCAACTGATTGGTGGTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1142393707 16:89819047-89819069 CTGCTCCACCAGCTTCTTGTGGG + Intronic
1202990547 16_KI270728v1_random:7294-7316 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1203058282 16_KI270728v1_random:946401-946423 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1142618025 17:1147946-1147968 GAGCACCAACGGCTTAGTGTTGG + Intronic
1143362287 17:6381990-6382012 TAGCTCCAAAATCTTGGAGTTGG - Intergenic
1144215055 17:13048092-13048114 CAGCTCCATCAGCCTGCTGGAGG + Intergenic
1145030095 17:19498415-19498437 GAAGTCCAACAGCATGGTGTCGG - Intronic
1146239016 17:31197676-31197698 TAGCTCTAACAGCTTGTTTTTGG + Intronic
1148549796 17:48543665-48543687 CAGTTCCAGCAGCTGCGTGTTGG + Exonic
1150832641 17:68537810-68537832 CAGCTACAACAGCTGTTTGTGGG - Intronic
1151523512 17:74647926-74647948 CAGCTCCAACTGCTGTCTGTGGG + Intergenic
1152745893 17:82038918-82038940 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1155379734 18:25206842-25206864 CAGCACCCACAGCATTGTGTGGG - Intronic
1155512494 18:26592430-26592452 CAGACCCCACAGCTTGGTGATGG - Intronic
1156159822 18:34346217-34346239 CAGGTACAACAACTTGGAGTTGG - Intergenic
1156554322 18:38049893-38049915 AAGCACCAATAGCTTGGTCTTGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1160240057 18:77116935-77116957 CAGCTCCGACCTGTTGGTGTTGG - Intronic
1162292566 19:9791165-9791187 CTGCTCCACCAGCTTCTTGTGGG - Intronic
1162752804 19:12838919-12838941 GGGCTCCAACAGCCTGGTGGGGG + Intronic
1163685350 19:18709171-18709193 CAGCTGCAGAGGCTTGGTGTTGG + Intronic
1163838037 19:19588037-19588059 AAGCTGCAGCAGCTTGATGTGGG + Intronic
1164435231 19:28222995-28223017 CAGCTCAAACAGCTCTGTGCTGG + Intergenic
1166649911 19:44565008-44565030 CATCTCCATCAGCAAGGTGTGGG - Intergenic
1167314184 19:48754352-48754374 CTGCTCCACCAGCTTCTTGTGGG - Intronic
1168465657 19:56599069-56599091 CAGCTACAAGAGCATTGTGTTGG + Intronic
925276198 2:2649918-2649940 CAGCTCCCACGGCTGGGTCTAGG - Intergenic
926577020 2:14593630-14593652 CAGTTTCTCCAGCTTGGTGTTGG - Intergenic
927614651 2:24580763-24580785 CACCTCCATCATCTTGGTATTGG + Intronic
930956417 2:57207971-57207993 CTTCTACAACAGCTTGATGTGGG - Intergenic
931638344 2:64360419-64360441 CAGCACCAACAGCCTGATGAGGG - Intergenic
932419907 2:71595592-71595614 CAGCCCGAACAGCCTGGTGCAGG + Intronic
936030674 2:109067926-109067948 CAGCTCCAGCTGCTGGGTGGAGG + Intergenic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
941664605 2:168231875-168231897 CAGCTGCAGCAGCTTGATGTGGG + Intronic
942088160 2:172462542-172462564 CTTCTGCAAGAGCTTGGTGTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
945450078 2:209984366-209984388 CAGTTCCAAGAGCTTGGTTGTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947046765 2:225995939-225995961 TATCTCCAACAGCTGGGGGTGGG + Intergenic
947332830 2:229048142-229048164 CAGTTACAACAGCATGGTATAGG + Intronic
948413952 2:237787204-237787226 TAGCCCCCACAGCCTGGTGTTGG + Intronic
1169758316 20:9066812-9066834 CAGCAACATCAGCATGGTGTGGG + Intergenic
1170682130 20:18535644-18535666 CACCCCCAGGAGCTTGGTGTTGG + Exonic
1170792575 20:19520331-19520353 CAACTCCAACAGCTCAGTGGAGG - Intronic
1171201600 20:23246445-23246467 CAGCTCCATCAGCTTTGCATGGG + Intergenic
1172622301 20:36327469-36327491 CAGAGCCCACAGCTTGGTGAAGG + Intronic
1172622594 20:36329546-36329568 CAGGACCAAAAGCTTGGTGGAGG - Intronic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1179094551 21:38300635-38300657 CATTTCTAAGAGCTTGGTGTAGG + Exonic
1181167565 22:20991814-20991836 CAGCTCCGACAGCGAGGTGAGGG + Exonic
1181176230 22:21038086-21038108 AAGTTCCAACAGCTTGGTGGTGG + Intergenic
1183627425 22:39013266-39013288 CAGCTCCACCAGCTTCTTGTGGG - Intergenic
1185386526 22:50534276-50534298 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
952300733 3:32102551-32102573 TAGCACCCACAGCTTAGTGTTGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955398079 3:58571588-58571610 CAGCTCCCACTCCTTAGTGTGGG + Intronic
955542597 3:59993679-59993701 CAGCTCCCACAGGCTGGTTTTGG - Intronic
955793522 3:62611660-62611682 CAGCTATAACAGATTGATGTAGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961440818 3:126952281-126952303 CAGCTGGACCAGCTGGGTGTTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964669274 3:159207774-159207796 TAGCTCCATCTGGTTGGTGTTGG + Intronic
964780317 3:160330038-160330060 CAGATTCAATAGCTTGGGGTAGG - Intronic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
965628169 3:170703325-170703347 AAGATTCAACAGCTTGGTGCTGG + Intronic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
968172406 3:196521179-196521201 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
969928630 4:10609285-10609307 CAGCTCTAACAGCTGCCTGTTGG + Intronic
972884487 4:43469152-43469174 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
973266803 4:48219361-48219383 CTGCTCCACCAGCTTCTTGTGGG + Intronic
973960931 4:56108990-56109012 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
974061546 4:57040391-57040413 CATCACAAACAGCTTGGTGGGGG + Intronic
976254418 4:83085155-83085177 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
977359731 4:95986730-95986752 CATCTCCAACACCTTGGGGTGGG + Intergenic
977537295 4:98269391-98269413 AAGCTCCATAAGATTGGTGTTGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982337358 4:154255508-154255530 CAGCTCCTACAGGTTGGTCCAGG - Exonic
984732008 4:183076905-183076927 CAGATCTAACAGCCTGGTATGGG - Intergenic
986827171 5:11534230-11534252 CAGTTACATCAGCTTGTTGTAGG + Intronic
988236168 5:28548078-28548100 TAGCCCCCACAGCCTGGTGTTGG + Intergenic
989354761 5:40530851-40530873 CAGCTGCAGCAGTATGGTGTTGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995739250 5:115337617-115337639 CAGCTCCAGGAGATAGGTGTAGG - Intergenic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
996626520 5:125576373-125576395 CAGCTCCAAGAGCATGTTCTTGG - Intergenic
997300320 5:132798958-132798980 CAACTCTATCAGCTTGGTGATGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1000494186 5:161957731-161957753 CAGCTTTAACACATTGGTGTGGG + Intergenic
1001789999 5:174448054-174448076 AAGCCCCAACACCTTGATGTGGG + Intergenic
1002369744 5:178742175-178742197 CAGCCCCCACAGCCTGGTGTTGG - Intergenic
1002501209 5:179648853-179648875 CAGCTCCTACAGGCTGGGGTGGG + Intergenic
1002635791 5:180608020-180608042 CTGCTCCACCAGCTTCTTGTGGG + Intronic
1002875396 6:1205061-1205083 CAGCTCCCACAGCCTGGCGAGGG - Intergenic
1004688210 6:17968425-17968447 CAACTACATCAGGTTGGTGTAGG + Intronic
1004688271 6:17968989-17969011 CATCTACATCAGGTTGGTGTAGG + Intronic
1007551642 6:42734311-42734333 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1009423926 6:63493443-63493465 CAACTCCAACAGTTTGAGGTTGG + Intergenic
1010716601 6:79237375-79237397 CAGTTCCAACAGTTTTGAGTAGG - Intergenic
1013760240 6:113509990-113510012 CAGCTGCTCCAGATTGGTGTTGG - Intergenic
1015163415 6:130177592-130177614 CTTCTGTAACAGCTTGGTGTTGG + Intronic
1015489026 6:133804555-133804577 TAACTCCAACAGAATGGTGTGGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015580519 6:134719372-134719394 TCACTCCAACAGCTGGGTGTTGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019204748 6:170350515-170350537 CACCTCCTACAGGTGGGTGTGGG + Intronic
1020009004 7:4798487-4798509 CAGCTCCACCAACTGGGTGTGGG - Intronic
1020216795 7:6198344-6198366 CTGGTCTAACAGCTAGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024174082 7:46820318-46820340 CTGCTCCATCAGCTTATTGTGGG - Intergenic
1024607353 7:51033146-51033168 CATCTTCATCAGCTTGGGGTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029494990 7:100891755-100891777 CAGCTCCAACTCCTTTGTCTTGG + Intronic
1029994319 7:104991955-104991977 CACCTCAAACATCTTTGTGTTGG - Intergenic
1035156811 7:156920906-156920928 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1035432799 7:158834957-158834979 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1038039276 8:23710238-23710260 CAGCCCCAACAGCGTGGTGCCGG + Intergenic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1041596908 8:59665812-59665834 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042915870 8:73875587-73875609 CAGCAGCAACATCCTGGTGTGGG + Intronic
1042933933 8:74039910-74039932 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1045392268 8:101727241-101727263 CAGATCCAACAGCTTGCTGATGG - Intronic
1046229322 8:111332466-111332488 CAGCTCCACCAGAATTGTGTCGG - Intergenic
1048042737 8:130746895-130746917 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1048415557 8:134224255-134224277 CAGCTCCCACAGCTATGTCTGGG + Intergenic
1048993825 8:139776706-139776728 TGGCTTCAAGAGCTTGGTGTAGG + Intronic
1049635024 8:143683515-143683537 CTGCTCCACCAGCTTCTTGTGGG + Intergenic
1049766666 8:144358301-144358323 CAGCACCAGCAGCATGCTGTCGG + Exonic
1055438874 9:76319669-76319691 CTGCTCCACCAGCTTCTTGTGGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1061066305 9:128279752-128279774 CTGCTCCACCAGCTTCCTGTGGG - Intronic
1061504729 9:131025443-131025465 CAGATCCTCCAGCTGGGTGTCGG + Intronic
1062088504 9:134661458-134661480 CAGCACCAACTGCTTTCTGTCGG + Intronic
1062173877 9:135150090-135150112 CTGCTCCACCAGCTTCCTGTGGG - Intergenic
1062377710 9:136270660-136270682 CTGCTCCACCAGCTTCTTGTGGG - Intergenic
1186020715 X:5252004-5252026 AAACTCCAGCAGCTTGGTATTGG + Intergenic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187702152 X:21973142-21973164 CAGTTCCAACTCCTTGGAGTTGG - Intronic
1190325686 X:49205618-49205640 CAGTGCCGACAGCTTGGTGGAGG - Exonic
1191758726 X:64624169-64624191 CAGTTTCACCAGCTTGGTGTAGG - Intergenic
1194583443 X:95704804-95704826 CAGCACCTTCAGCCTGGTGTGGG + Intergenic
1194651506 X:96520349-96520371 CAGCTCCAGCAGCCTTTTGTTGG + Intergenic
1194974958 X:100385222-100385244 CAGCTTCACCAGATTGGTGGTGG + Intronic
1197673124 X:129300320-129300342 CAAGTCCAAGAGCATGGTGTTGG - Intergenic