ID: 1097625425

View in Genome Browser
Species Human (GRCh38)
Location 12:61994294-61994316
Sequence CAGTGTATCAAGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097625425_1097625426 27 Left 1097625425 12:61994294-61994316 CCTTCTTCTCTCTTGATACACTG 0: 1
1: 0
2: 2
3: 25
4: 323
Right 1097625426 12:61994344-61994366 CAATGTCTCCAGCCATGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097625425 Original CRISPR CAGTGTATCAAGAGAGAAGA AGG (reversed) Intronic
902702208 1:18180078-18180100 CAGTGGATAAAGGGAGTAGAGGG - Intronic
903276444 1:22224928-22224950 AAGTGAAGCAAAAGAGAAGAAGG - Intergenic
903697501 1:25218896-25218918 CAGTGTCTCAAAAGAGAAACAGG - Intergenic
904251168 1:29225338-29225360 CAGTGTATGAGGAGAGAAAGTGG - Intronic
904330533 1:29755454-29755476 CAGTGTCTGGGGAGAGAAGATGG + Intergenic
904416144 1:30362140-30362162 CAGTGTCTGGGGAGAGAAGATGG - Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905809917 1:40904674-40904696 CCCTGTCTCAAGAGAAAAGAAGG + Intergenic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
907943187 1:59108340-59108362 AAGTTACTCAAGAGAGAAGAGGG + Intergenic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909590303 1:77341094-77341116 CATTGTATCAAAGGAGCAGAAGG - Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
912493574 1:110076730-110076752 CACTGGAGGAAGAGAGAAGAGGG + Intergenic
912556225 1:110518074-110518096 CAGTGTCTCCAGGCAGAAGATGG + Exonic
913149736 1:116029010-116029032 CAGTTTAGAAAGAGAGAACATGG - Intronic
914351533 1:146844200-146844222 CTGTGTATCAACAGAGCAGGAGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
920104302 1:203540103-203540125 GAATGCATCAAGTGAGAAGAAGG + Intergenic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922112601 1:222576287-222576309 CAGAGTATCTTGAAAGAAGAGGG + Intronic
922885121 1:229014001-229014023 CAGTGTATGAAAACAAAAGAGGG - Intergenic
924942609 1:248822476-248822498 CAGTTTAGCAAGAGAGACGAGGG + Intronic
1065162645 10:22938861-22938883 AAGTGTATCCAGAGAGATGGAGG + Intronic
1065367410 10:24950032-24950054 AGGGGTATCAAGAGAGTAGAGGG - Intronic
1066602537 10:37124587-37124609 CAGTTTATCACTAGAAAAGATGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070647297 10:78210833-78210855 GATTCTATCAAGAAAGAAGAGGG + Intergenic
1070654992 10:78265334-78265356 CAGTGTATCACAAGGCAAGAGGG + Intergenic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1071345869 10:84692025-84692047 CATTGTAACAAGAGAAAAGGAGG + Intergenic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072961079 10:99929784-99929806 CAGTGTACCAGGGGAGAACAAGG - Intronic
1073035029 10:100558119-100558141 GAGAGTCTCAAGAAAGAAGATGG + Exonic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074215839 10:111382834-111382856 CACTGTGTTAAGAGAAAAGAAGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1079614995 11:22481210-22481232 AGGTGTATTGAGAGAGAAGAGGG - Intergenic
1079878789 11:25896619-25896641 CAATGTATTCAGAGAAAAGAAGG + Intergenic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1080603891 11:33847822-33847844 CAGTGATTAAAGAGAAAAGATGG - Intergenic
1080715336 11:34794628-34794650 CAGAATATCGAGAGAGAAGCAGG + Intergenic
1081620352 11:44615630-44615652 CAGTGTAGCTTGAGATAAGAGGG - Intronic
1083222130 11:61259305-61259327 CAGGGAATCTAGAGAGACGAGGG + Exonic
1086092158 11:83015666-83015688 GAGTGGATAAATAGAGAAGAGGG + Intronic
1086096237 11:83052620-83052642 CAGGGGAACACGAGAGAAGAAGG + Intronic
1086194027 11:84115544-84115566 CAGTCTAGTAAGGGAGAAGAAGG - Intronic
1087097400 11:94332362-94332384 AAGTTTATCAAGAGAGATGGTGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088803574 11:113330042-113330064 CAGTGTATCAAGATAGGAAAGGG + Intronic
1090453285 11:126825425-126825447 CACTGTATTAATAAAGAAGAAGG - Intronic
1090708789 11:129366243-129366265 CAGGGCATGAAGAGAGGAGAGGG - Intergenic
1090919368 11:131194535-131194557 CATTTTAACAAGAGAGAAGCGGG - Intergenic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091479898 12:816933-816955 AAGTGTATAAAGAGAAAAGAAGG + Intronic
1092097628 12:5856691-5856713 CAAAGTGTCAAGAGAGAAGCTGG + Intronic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1094395038 12:29996458-29996480 GAGGGTATCAAGATACAAGAAGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095337683 12:41048357-41048379 CATTGACTAAAGAGAGAAGATGG - Intronic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098013562 12:66080357-66080379 CAGTGAAACAAGGGAGAAGTGGG + Intergenic
1098098709 12:66989280-66989302 CAGAGTAGCAACAAAGAAGAAGG - Intergenic
1099363810 12:81742863-81742885 AAGTGTCTCAAGAAAGAAGGGGG + Intronic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1102320619 12:111930428-111930450 TAATGTATCAAGTGAGAATAAGG + Intergenic
1103286004 12:119802294-119802316 CATTGTATCATGAGAGAATGAGG + Intronic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107063608 13:36187984-36188006 GAGTGTTTCAAGAGACAGGAAGG - Intronic
1107628104 13:42311290-42311312 TAGTGTTTCAAGAGTGAAGTAGG + Intronic
1107632885 13:42360431-42360453 AAATCTATCAAGTGAGAAGAGGG + Intergenic
1108141722 13:47429925-47429947 TAGAGTATCAAAAGAGAAGCAGG + Intergenic
1108816838 13:54303002-54303024 CAGTGTTTCTAGGGACAAGAAGG + Intergenic
1108828383 13:54445229-54445251 CAGTGAATTAAGAGAGAATTAGG - Intergenic
1110426096 13:75369110-75369132 TGGTGTAACAAGACAGAAGATGG + Intronic
1111466341 13:88616375-88616397 CAGTGTATTAAGAAAGATGATGG + Intergenic
1112985389 13:105443301-105443323 CACTGTATCAACAGAGAAAGTGG - Intergenic
1114285618 14:21239865-21239887 CTGGGTCTCAAGAGAGAAAAAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1116521095 14:45848082-45848104 CAGTGTCTGAAGACAGGAGAAGG + Intergenic
1117048898 14:51841080-51841102 CAGTTTAGCAAGTAAGAAGATGG + Intronic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1118867239 14:69713130-69713152 CAGAGTAACAAGATAGAAAAAGG - Exonic
1118908523 14:70042026-70042048 CAATGCATCCAAAGAGAAGATGG + Intergenic
1119401846 14:74368054-74368076 CAGTGAATGAGCAGAGAAGATGG + Intergenic
1119733221 14:76964363-76964385 CAGGGTATAGAGTGAGAAGATGG + Intergenic
1120764182 14:88313466-88313488 AAGTGATTCAAGAGAGAACAAGG - Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1123625499 15:22224270-22224292 CAGTCTATTAACAGGGAAGACGG + Intergenic
1123897035 15:24839688-24839710 CAGTGAAACAACAGAGCAGATGG - Intronic
1125794635 15:42395207-42395229 CAGTGTATCAAGGGAGGCTATGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126115466 15:45203583-45203605 CAGTGTACCTAGAGATAAGTAGG - Intergenic
1126185386 15:45826260-45826282 CAATGTATAAATATAGAAGAAGG + Intergenic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1126980912 15:54241711-54241733 CACTGTATAAAGAGAAAAGGGGG - Intronic
1127065096 15:55229142-55229164 CAGAGTACCAAGACAGAATAAGG - Intronic
1127128314 15:55835331-55835353 CAGAGTTTCAATAGAAAAGATGG - Intronic
1127142974 15:55995341-55995363 ATGTGTATCATGAGAGATGAGGG - Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1132294078 15:100722364-100722386 CACTGGATCAAGGGACAAGATGG - Intergenic
1133463566 16:6008242-6008264 GAGTGAATAAAGAGACAAGAGGG + Intergenic
1133854572 16:9537450-9537472 CAAAGTAGCAAGTGAGAAGAGGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1135533592 16:23275506-23275528 CTGTCTATCTAGAGAGCAGAAGG + Intergenic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136702998 16:32160367-32160389 CAGTTTAGCAAGTGAGAAAAGGG - Intergenic
1136764702 16:32767229-32767251 CAGTTTAGCAAGTGAGAAAAGGG + Intergenic
1136803397 16:33103155-33103177 CAGTTTAGCAAGTGAGAAAAGGG - Intergenic
1138946089 16:61851769-61851791 CAGTGTAGCATCAGAGAAAATGG - Intronic
1140777448 16:78263074-78263096 CAGTGTAGCAAGCCAGAAGCTGG + Intronic
1141862662 16:86728531-86728553 CAGTGTATGAAGAGCGAACAGGG + Intergenic
1203067058 16_KI270728v1_random:1029354-1029376 CAGTTTAGCAAGTGAGAAAAGGG + Intergenic
1143316849 17:6039358-6039380 CAGTGTCTCAAGAGACAAATAGG - Intronic
1143756868 17:9073693-9073715 CAGTTTTTGAAGAGAGAATATGG + Intronic
1143863538 17:9908133-9908155 CAGTGTTACAAGTGAGAAGTGGG + Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144391877 17:14801062-14801084 CAGTGTTCCAAGAGAGAATGTGG - Intergenic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1148238943 17:45987450-45987472 CAGTTTATGCAGTGAGAAGATGG - Intronic
1148833821 17:50454744-50454766 GGGTGTGTCATGAGAGAAGAAGG + Intronic
1148939274 17:51193972-51193994 CAGTGTTTCTAGAGAGGGGAGGG - Intronic
1148972295 17:51494435-51494457 CAGGGTGTCAAGTGAGGAGATGG + Intergenic
1150600281 17:66645360-66645382 CTGTGAATCAAGAAAGGAGAGGG - Intronic
1150781623 17:68127615-68127637 CAGAGTATCAGGAGGGAACAGGG - Intergenic
1150893820 17:69185854-69185876 CAGAGCATCAAGAGAAAAGGTGG + Intronic
1152846238 17:82601404-82601426 AAGCGGATCAAGACAGAAGACGG + Exonic
1153910885 18:9706111-9706133 GAGTGTAACAATAGAGAACATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155618938 18:27753643-27753665 CAGTGTATGAGAAGAGAAGGAGG - Intergenic
1155857945 18:30858262-30858284 CATTGTACAAAGAGAGAAAAAGG - Intergenic
1156179345 18:34584794-34584816 AAGTGTTTTCAGAGAGAAGAAGG + Intronic
1157733523 18:50025468-50025490 CAGGGCACCAAGAGAGGAGATGG - Intronic
1157864468 18:51168779-51168801 AAGTGTACCAATTGAGAAGAGGG - Intergenic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1160057199 18:75494196-75494218 CAGTGTCTGAAGAGTGAAAAAGG + Intergenic
1160739359 19:678898-678920 GAGTGGATCAGGAGAGAACATGG + Intronic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1162310030 19:9900882-9900904 CCTTGTTTCAAGAGAGGAGAGGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1164237068 19:23346521-23346543 CAGTTAAACAAGAGAGAAAAAGG - Intronic
1164559667 19:29281411-29281433 CAGATGATCAATAGAGAAGATGG - Intergenic
1165045103 19:33098342-33098364 CAGGGACTCAAGGGAGAAGACGG - Intronic
1165549090 19:36568150-36568172 AAGTGTTTCAATAGAGAATAGGG - Intronic
1167964434 19:53132043-53132065 CACAGTATCCAGAGAGATGAAGG - Intronic
926938628 2:18112764-18112786 CAAGGTATCAGGAGAGAGGAGGG + Intronic
927635829 2:24815914-24815936 CAGAGTTTCAAAAGAAAAGAGGG - Intronic
927676783 2:25112071-25112093 CAGCATATCCAGTGAGAAGAGGG - Intronic
928739052 2:34328275-34328297 AATTGTAACATGAGAGAAGATGG - Intergenic
929331457 2:40686426-40686448 CAGTGTGTCAAGAGAGAAAAAGG + Intergenic
929335510 2:40739491-40739513 AAATGTATCAAGATAGAAAATGG - Intergenic
929588040 2:43128227-43128249 CAGTCTAGGTAGAGAGAAGAAGG + Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
931391226 2:61845786-61845808 CCTTGTATCAAGAAAAAAGAAGG + Intronic
931645994 2:64422525-64422547 GAGTGTTTCAAGAGACAAAATGG - Intergenic
931663761 2:64595227-64595249 CAGGGTAGAAAGAGTGAAGAAGG + Intergenic
933168231 2:79097550-79097572 CAGTTAAACAAGAGAGAAAAAGG + Intergenic
933323432 2:80806131-80806153 CAGGTTATAAAGAGAGCAGATGG + Intergenic
934099371 2:88637951-88637973 AAATGTCTCAAGAGAGAAAATGG - Intergenic
936232600 2:110716313-110716335 CAATGTATAAACAGACAAGAAGG + Intergenic
936282446 2:111153931-111153953 CACTGCATCGGGAGAGAAGAGGG - Intronic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937514692 2:122640112-122640134 AAATGTATTAAGAGAGAAGATGG - Intergenic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
938824957 2:134995444-134995466 CAGTGGATCCAGAGAGCAGGTGG + Intronic
938826819 2:135013857-135013879 CAGAGGATCAAGAGAGAGGAGGG - Intronic
939496811 2:142935237-142935259 CAGTTAAACAAGAGAGAAAAAGG + Intronic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
940486188 2:154298111-154298133 AAATGTATAAAGAGAGATGAAGG + Intronic
940628256 2:156204210-156204232 GGGTGTATTGAGAGAGAAGAGGG - Intergenic
941801969 2:169669985-169670007 AAGAGTAGAAAGAGAGAAGAGGG - Intronic
941900430 2:170672739-170672761 CAGGGAAGCTAGAGAGAAGAGGG - Intergenic
942271691 2:174281957-174281979 CAGTGTTTCAAGGGAGAGCAAGG + Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
943430589 2:187796200-187796222 AAGTGTACCAAGAGGGATGATGG + Intergenic
944322474 2:198364214-198364236 CAATGTCTCATGAGAGAAGGGGG + Intronic
944907078 2:204272650-204272672 TAGTCAATTAAGAGAGAAGAAGG + Intergenic
945940053 2:215940193-215940215 TAGTGTGTCAAAACAGAAGATGG + Intergenic
946730211 2:222702207-222702229 CAGTGTCATAAGAGACAAGAGGG + Intronic
946748343 2:222867686-222867708 AAGTCTATCAAGAGAGCAAAGGG - Intronic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947219511 2:227779111-227779133 ACGTGTGTCAAGAGAGAAGTAGG + Intergenic
947318790 2:228894590-228894612 GAATGTAACAAGAGAGAAAATGG - Intronic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
1169680270 20:8204197-8204219 CAATGTGTCAAGGGAGCAGAGGG + Intronic
1169847770 20:10014319-10014341 CAGTGCATCAAGAAACAATATGG + Intronic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1171166209 20:22974160-22974182 TAGTGCATCAAGTGAGGAGATGG - Intergenic
1172544115 20:35746132-35746154 CACTGTTTCAAGAAAGAAAAAGG - Intergenic
1173135741 20:40437335-40437357 CATTGTACCAAAAGTGAAGAAGG + Intergenic
1174643153 20:52062705-52062727 CAGTGAACAAAGAGAGGAGAGGG + Intronic
1177689578 21:24488029-24488051 CAGAGTAACAAGAGAGAACCTGG - Intergenic
1178023945 21:28443482-28443504 CAGAATGTCAAGAGAGAAGGAGG - Intergenic
1178433561 21:32537318-32537340 CAGAAGATCATGAGAGAAGATGG + Intergenic
1178759941 21:35392643-35392665 CACTGGATGAAGAGTGAAGAGGG + Intronic
1181890963 22:26063076-26063098 CGGTGTAACAGCAGAGAAGATGG - Intergenic
1181931941 22:26408858-26408880 CTGTGTCTCAAGAAAGAAAAAGG - Intergenic
1183652062 22:39162224-39162246 CTGTGAATCAAGTGGGAAGATGG + Intergenic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184972126 22:48031344-48031366 CAATGTATCAAAAAATAAGATGG - Intergenic
950791050 3:15472651-15472673 CAGAGAATAAAGAGAGAAAAGGG - Intronic
951037897 3:17953405-17953427 CACTGTGTCAGGAGAAAAGAGGG - Intronic
952036266 3:29205829-29205851 CAATGTTTCAATACAGAAGAGGG - Intergenic
952051317 3:29387893-29387915 CAGTAAATTAGGAGAGAAGAAGG - Intronic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
954792569 3:53144076-53144098 CACTGAAGCCAGAGAGAAGAGGG - Intergenic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958751652 3:98199161-98199183 AAGAGTATGAAGTGAGAAGAAGG - Intergenic
958777166 3:98499796-98499818 CAGAGCATCAAGAGAGGAGGTGG - Intronic
959145842 3:102543473-102543495 CCATATATAAAGAGAGAAGATGG - Intergenic
959930183 3:111972088-111972110 CAGTGTTTCAAGCAAGCAGAAGG - Intronic
960244988 3:115390474-115390496 CATGGTATCAAGAGAGGGGAGGG - Intergenic
961007994 3:123417648-123417670 CAGTATCTCAAGTCAGAAGATGG + Intronic
961601251 3:128063902-128063924 CAGAGTAACAAGTGAGAGGAAGG - Intronic
963706393 3:148693375-148693397 AAGTTTCTGAAGAGAGAAGAGGG - Intergenic
963952483 3:151218241-151218263 CAGTGAATCAACTGAGAAGTGGG - Intronic
964744583 3:160000513-160000535 CAGTTTAGCAAGAGAGAGAAGGG - Intergenic
965848214 3:172989246-172989268 CAGTTTATCTAGAGATAAGTAGG + Intronic
966706048 3:182915028-182915050 CAGGTTATAAAGAGTGAAGAAGG + Intronic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
970370739 4:15403577-15403599 CAATGTATCCTGAGAAAAGAAGG - Intronic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971498729 4:27295918-27295940 AAGTGAATAAAGAGAAAAGAGGG + Intergenic
972511415 4:39771167-39771189 CCGTGTAGCAGGAGAGAAGCAGG + Intronic
972997816 4:44904310-44904332 AAAGGGATCAAGAGAGAAGAAGG + Intergenic
973184543 4:47310275-47310297 TAAGGTCTCAAGAGAGAAGATGG - Intronic
973205858 4:47559552-47559574 AAGTTTAGCAAGAAAGAAGATGG + Intronic
974046327 4:56901768-56901790 TCCTGTCTCAAGAGAGAAGAGGG + Intergenic
974958708 4:68673815-68673837 CAGTTAAACAAGAGAGAAAAAGG - Intergenic
978181879 4:105807989-105808011 CATAGGATCAAGAGAGAAGAAGG - Intronic
978676092 4:111317918-111317940 GAGTGTCCCAAGAGATAAGATGG - Intergenic
980570054 4:134602891-134602913 CAGTGGAACAAGAGAACAGATGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981650835 4:147056523-147056545 AAGGGTATAAAGACAGAAGATGG + Intergenic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
983468738 4:168128894-168128916 AAGTATATAGAGAGAGAAGAAGG + Intronic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
985148236 4:186917717-186917739 CAGCGTATCATGAGAGAAAGAGG + Intergenic
985275075 4:188230233-188230255 CAGTGAATGAATAGAGAACAAGG - Intergenic
987009100 5:13741999-13742021 AAATGAATCAAGGGAGAAGATGG - Intronic
987481294 5:18461767-18461789 CAAAGTAGCAAGAGAAAAGAGGG - Intergenic
988581377 5:32471836-32471858 AAGTGTAGCAAGAGAAGAGAAGG - Intergenic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
989585873 5:43073570-43073592 CAGTTAAACAAGAGAGAAAAAGG + Intronic
990270772 5:54136017-54136039 CAGAGTTTCAAGACAGCAGAAGG + Intronic
991145015 5:63291172-63291194 CAGAGTAGCAGGAAAGAAGAGGG - Intergenic
992271926 5:75073484-75073506 CAGTGTATTAATTGAGAAGATGG - Intronic
993076886 5:83243420-83243442 AAGTGTATGTACAGAGAAGAAGG - Intronic
993233469 5:85270146-85270168 GAGTGTATCAGGAGAAAAGGGGG - Intergenic
993273015 5:85819102-85819124 CAGGGGATCATGACAGAAGAAGG - Intergenic
993371386 5:87096919-87096941 CACTGAATCCTGAGAGAAGATGG - Intergenic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
998030271 5:138860852-138860874 GGGTCTATCAGGAGAGAAGATGG + Intronic
998336322 5:141375492-141375514 CAGTGCATTCACAGAGAAGATGG - Exonic
998536693 5:142939327-142939349 CAGTGGATGAAGGGAAAAGAAGG + Intronic
999952802 5:156668511-156668533 AAATATATCAAGGGAGAAGATGG - Intronic
1000748235 5:165062143-165062165 CAGTGGATCTAGAGCGAACAGGG - Intergenic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005268713 6:24140576-24140598 AAGCGCATCAAGAGCGAAGATGG - Intronic
1008097477 6:47353953-47353975 CAGTGTTTCAATAAAAAAGAAGG - Intergenic
1009935175 6:70225310-70225332 CAGTGTATAAAGAGAACAGAAGG + Intronic
1010084865 6:71905364-71905386 CACTGCTTCAAGATAGAAGAGGG - Intronic
1014398061 6:120951278-120951300 AAGAGTATGAAGAGAAAAGATGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1017380860 6:153827592-153827614 CAGTGAGGCAAGAGAGAACAAGG - Intergenic
1018141659 6:160843765-160843787 CAGTGTACCCAGAGAATAGATGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1019841508 7:3450798-3450820 AATTGCATGAAGAGAGAAGAGGG + Intronic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1024197206 7:47071083-47071105 CAGGGAAACAAGAGAGGAGAGGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1026815132 7:73505047-73505069 CAGGCTGGCAAGAGAGAAGAGGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1029177039 7:98672111-98672133 CCCTGGATCCAGAGAGAAGATGG + Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029518605 7:101045024-101045046 CACCCTAACAAGAGAGAAGAAGG - Intronic
1030283780 7:107804125-107804147 GAGGGTAGCAAGAGAGGAGAAGG - Intergenic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1035448958 7:158962365-158962387 TTGTGCATCAAGAGAGAAGTTGG + Intergenic
1036719077 8:11155913-11155935 CATTGCATCAGGAGAGAAGGAGG - Intronic
1036761450 8:11512032-11512054 CAATGTATCAAGTGGTAAGATGG + Intronic
1037084057 8:14824812-14824834 GAGTAGATCAATAGAGAAGAAGG - Intronic
1037736886 8:21574588-21574610 CAGAGAATCAAGTGAGAAGATGG - Intergenic
1038932779 8:32213791-32213813 CAGCTTAACAAGAGAGAAGCAGG + Intronic
1039546303 8:38413694-38413716 CAGCGGCTCATGAGAGAAGACGG + Exonic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040433187 8:47364028-47364050 CATTGTTTCAGGAGAGAACATGG + Intronic
1040741559 8:50581678-50581700 CAGTGTATCAAGTGAGGGAAGGG + Intronic
1041441490 8:57901673-57901695 TGGTGTTTTAAGAGAGAAGAGGG - Intergenic
1044043821 8:87404103-87404125 TATTAGATCAAGAGAGAAGAAGG + Intronic
1045701007 8:104866103-104866125 AACTGTATCACCAGAGAAGAAGG + Intronic
1045972864 8:108099471-108099493 CAGAGTATGATGAGAGAATAGGG + Intergenic
1046751101 8:117927554-117927576 CAGACTCTCAAAAGAGAAGATGG + Intronic
1046820400 8:118628565-118628587 CAGAGGAGCAAGAGAGAAAAAGG + Intergenic
1047167782 8:122459534-122459556 CAATATAACAAGAGAGAAAAGGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1048327527 8:133450847-133450869 CAGTGTACCAGGAGAGAAACAGG - Intergenic
1048636512 8:136301545-136301567 TAGTGTATCCAGACAGAAAAGGG + Intergenic
1049569617 8:143363003-143363025 CACGGTAACAGGAGAGAAGATGG - Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1052240078 9:26261338-26261360 CAGGGCATCAAGTGAGGAGATGG + Intergenic
1052709472 9:32035769-32035791 CAGAGTATGAATAGAGAAGCAGG + Intergenic
1053609471 9:39697474-39697496 GAGTGTACCAGGAGAGCAGAAGG - Intergenic
1053867367 9:42454059-42454081 GAGTGTACCAGGAGAGCAGAAGG - Intergenic
1054088844 9:60774018-60774040 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1054244053 9:62644923-62644945 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1054558178 9:66679471-66679493 GAGTGTACCAGGAGAGCAGAAGG + Intergenic
1056295505 9:85189361-85189383 CATTGTATTAAGAGAGAAAGTGG + Intergenic
1056305626 9:85288182-85288204 CAGTCTATTACGTGAGAAGATGG + Intergenic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1060248246 9:121964657-121964679 GAGTGTATTAGGAGAGAGGAAGG - Intronic
1061150344 9:128824604-128824626 CAGTGCATCCAGGGAGAACAAGG + Intronic
1185458653 X:323360-323382 CAGTCTATTAACAGGGAAGACGG - Intergenic
1186248468 X:7640212-7640234 CTGTGTATGAAGAGAGTAGAGGG + Intergenic
1186387430 X:9124349-9124371 CTCTTTATCAAGAGAGAAAAAGG + Intronic
1187324896 X:18277813-18277835 CAGTGTAATAGGGGAGAAGATGG + Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187991594 X:24879929-24879951 CACAGTATAACGAGAGAAGATGG + Intronic
1188058941 X:25576791-25576813 AATTATATCAAGATAGAAGATGG - Intergenic
1189051720 X:37652393-37652415 CTGAGTATGAAGAGACAAGAGGG - Intronic
1191684042 X:63870664-63870686 AAAGGTATTAAGAGAGAAGATGG + Intergenic
1191852343 X:65594702-65594724 CAGTGAATCAGGAGAGAAGTAGG + Intronic
1192736751 X:73856429-73856451 TAGTTTATCAAAAGAGAACACGG + Intergenic
1193099954 X:77598623-77598645 CAGATTATGAAGAGAGAACAAGG - Intronic
1194287493 X:92028391-92028413 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1196058940 X:111386698-111386720 CAGTTCATCCAGAGAAAAGAGGG - Intronic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1198514201 X:137388073-137388095 CAGTGTAGCTAAATAGAAGAAGG + Intergenic
1199279877 X:145988959-145988981 GCGTGTATGAAGAGAGAAGGCGG + Intergenic
1200605032 Y:5252958-5252980 CAGTGTAGAAATAGTGAAGAAGG - Intronic
1201452850 Y:14135188-14135210 CAGTGTATCAGGAAAGGACAAGG - Intergenic