ID: 1097625430

View in Genome Browser
Species Human (GRCh38)
Location 12:61994373-61994395
Sequence TTGAAAAGGCAACAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 471}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097625430 Original CRISPR TTGAAAAGGCAACAGGAGGA AGG (reversed) Intronic
901309199 1:8255998-8256020 TTAAAAAGGTAATAGGAGGCCGG - Intergenic
901868925 1:12126160-12126182 CTGAAACGACACCAGGAGGAAGG - Intronic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
902587056 1:17446190-17446212 TTCAAAAGGCAGCAGGAGGCCGG - Intergenic
902973555 1:20072467-20072489 ATGAAAAGGGAACAGGGGGAGGG + Intronic
903334510 1:22616006-22616028 TTGGAAAGTCACCAGGAGAATGG - Intergenic
903488292 1:23707843-23707865 GTGAGAGGGCAAGAGGAGGAGGG + Intergenic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
906192122 1:43905319-43905341 TGGGAAGGGGAACAGGAGGAGGG - Intronic
906192167 1:43905466-43905488 TGGGAAGGGGAACAGGAGGAGGG - Intronic
906192274 1:43905864-43905886 CGGGAAAGGAAACAGGAGGATGG - Intronic
906192416 1:43906369-43906391 CGGGAAAGGAAACAGGAGGATGG - Intronic
906222116 1:44088949-44088971 ATAAAAAGACCACAGGAGGAGGG + Intergenic
906465357 1:46073928-46073950 TAGAAAAGGCAACAGTTGGCCGG - Intronic
908323495 1:63000927-63000949 TTAAAAAGCCAAAAGGAGGGTGG - Intergenic
908702565 1:66918632-66918654 ATGAAGAGGAAACGGGAGGAAGG - Intronic
909480623 1:76125798-76125820 TTAAAAATGCATCAGGATGAAGG - Intronic
910869186 1:91816142-91816164 TGGAGAAAGCAACAGAAGGATGG + Intronic
911790476 1:102009745-102009767 TTGGAAAGGAAACAGTAGGGAGG + Intergenic
912711445 1:111952803-111952825 TTGAAAAGCCAGCAAGGGGAGGG + Intronic
913692500 1:121292684-121292706 AGGAAAAGGCAACAGGACGAGGG + Intronic
914145056 1:144987410-144987432 AGGAAAAGGCAACAGGACGAGGG - Intronic
914336038 1:146715746-146715768 TTGAAAATAAAACATGAGGAGGG + Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914678633 1:149923508-149923530 GGGAAAATGTAACAGGAGGAAGG + Exonic
915119079 1:153617334-153617356 TTGAGAAGGTGACATGAGGAGGG - Intergenic
915595299 1:156893586-156893608 TTGACAAGGAAACAGGAGCCGGG - Intergenic
915914304 1:159931817-159931839 TCCAAGAGACAACAGGAGGAGGG + Exonic
915979878 1:160413673-160413695 ATGAGAAGGCCAGAGGAGGAGGG - Intronic
916310793 1:163396776-163396798 TGGAAAAGGCCAGAGGAGGTGGG - Intergenic
916461461 1:165029170-165029192 TTGAAAAGCCTACAGGATGGGGG + Intergenic
917846542 1:179025462-179025484 TTAAAAAGGCAACAGGAGGAGGG + Intergenic
918004235 1:180526715-180526737 TAGATAAGGCAACAGGACGGTGG + Intergenic
918761773 1:188419588-188419610 ATGAAAAGCCATCACGAGGATGG + Intergenic
918872284 1:189991099-189991121 GTGAAAATGGAACTGGAGGAAGG - Intergenic
920479819 1:206311041-206311063 AGGAAAAGGCAACAGGACGAGGG + Intronic
920758044 1:208754111-208754133 TTGAAAAGAAAACAAGAAGAGGG + Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921244338 1:213220619-213220641 TTAAAATGGCAACAGAAGGCTGG - Intronic
921326564 1:213990092-213990114 TGGAAAAGAGAACAGGAGAAGGG - Intronic
922447257 1:225707911-225707933 TGAAATAGGAAACAGGAGGAAGG + Intergenic
922780725 1:228250351-228250373 TGGAAATGGGAGCAGGAGGATGG - Intronic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
1063773522 10:9232395-9232417 TTGAAAAGGCAAGAGTCAGAAGG - Intergenic
1063823366 10:9863835-9863857 GTGAAGCGGCAACAGGAGGGTGG + Intergenic
1063878146 10:10501941-10501963 TTGAAAAAGAAACAGGAATAGGG - Intergenic
1064609637 10:17084889-17084911 TTGAAAGGGGAACAGGAGGTTGG + Intronic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1065003750 10:21361173-21361195 CTCACAAGGCGACAGGAGGAAGG + Intergenic
1065458895 10:25934828-25934850 GTGAAGTGGAAACAGGAGGAGGG + Intronic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066394721 10:35008112-35008134 ATGAAAAGGAAAAAGGAGCAAGG - Intergenic
1067713587 10:48670303-48670325 TTGAAAAGGCAACATTTAGAAGG + Intergenic
1068157277 10:53216967-53216989 TTGAAAAGGGACAAAGAGGAAGG - Intergenic
1068620278 10:59174831-59174853 TTGAAAAAGTAAAAGTAGGATGG - Intergenic
1068698243 10:59992310-59992332 TTGAAAAGGCAAAAGTGTGAGGG + Intergenic
1069026688 10:63550137-63550159 TTGAAAATAAAACAAGAGGATGG + Intronic
1069642157 10:69963033-69963055 TGGTGAAGGAAACAGGAGGATGG + Intronic
1070673066 10:78391719-78391741 CTGACAAGGCAACAGGAAAAGGG - Intergenic
1070684514 10:78471043-78471065 TTTATAAGACTACAGGAGGATGG + Intergenic
1071125575 10:82331202-82331224 ATGAAAAGACAACAGGTGAAAGG - Intronic
1071546523 10:86534228-86534250 TTGAAATGACAACAGAAGGATGG - Intergenic
1072665330 10:97388528-97388550 TGGAAATGGCAGCAGGATGATGG + Exonic
1072810239 10:98455924-98455946 TGGAAAAGGCAAGAGAAGAAAGG - Intergenic
1072945016 10:99801960-99801982 TTTAAAAATCAACTGGAGGAAGG - Intronic
1073088275 10:100910215-100910237 TGTTAAAGACAACAGGAGGAGGG - Intergenic
1073453918 10:103625280-103625302 TTGAAAAGGCTGCACCAGGAAGG - Intronic
1073893975 10:108132622-108132644 TTGATAAGGAAAGAGGAAGATGG + Intergenic
1074086790 10:110214415-110214437 TGGGAAAGGCAGCAGGAGGGGGG - Intronic
1074150430 10:110754974-110754996 TCCAAAAGGCAACCAGAGGAAGG - Intronic
1074447391 10:113531665-113531687 GTGAAACTGCAGCAGGAGGATGG - Intergenic
1074826454 10:117218464-117218486 TGGAAAAGGCAACAGGCAGCTGG - Intergenic
1074947422 10:118294949-118294971 TTGACATGGAAAAAGGAGGAAGG + Intergenic
1075614594 10:123882291-123882313 CTGTAAAGGCCAGAGGAGGAAGG + Intronic
1075930341 10:126289732-126289754 TTTAAGAGGCTACAGTAGGAGGG + Intronic
1076140723 10:128077020-128077042 CTGAGAAGGCACCTGGAGGAGGG - Intronic
1076228487 10:128800129-128800151 TGACAAAGGCAGCAGGAGGAAGG + Intergenic
1076266241 10:129111778-129111800 TCAAAAGGGCATCAGGAGGAAGG + Intergenic
1076707886 10:132311705-132311727 ATGAAAAGGCAACGTGATGATGG - Intronic
1076782718 10:132733124-132733146 AAGAAAAGGCCACATGAGGATGG - Intronic
1077003840 11:341117-341139 AGGAAAAGGAAAGAGGAGGAAGG + Intergenic
1078127508 11:8582486-8582508 TTCACAAGGCAGCAGGAAGAGGG + Intronic
1078712770 11:13811635-13811657 TTAAAAAGCCAACAAGAGGCTGG - Intergenic
1079939817 11:26665557-26665579 TTGAAAAAGGAATTGGAGGATGG + Intergenic
1080431109 11:32200710-32200732 TTGGGAAGGCAACAGAAGGATGG + Intergenic
1080574085 11:33582651-33582673 TGGAAAGGGCAACAGGGTGATGG - Intronic
1080779592 11:35418737-35418759 TTGAAAATGCGAGAGGTGGAGGG - Intronic
1080904762 11:36531663-36531685 TAGAAAACGCAAGAGGAGAAGGG + Intronic
1080981241 11:37408879-37408901 TAGAAGAGGTGACAGGAGGAAGG - Intergenic
1081586380 11:44386978-44387000 TTGAAAAGCAAATAGGAGGCAGG - Intergenic
1081847582 11:46251923-46251945 TTGAAAAGGCATCTGGGGGTGGG - Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1082169479 11:48985788-48985810 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1082234736 11:49810299-49810321 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1082238068 11:49843879-49843901 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1082608437 11:55270994-55271016 TTGATAAGGCACAAGGAAGAGGG - Exonic
1082658561 11:55881304-55881326 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1082665315 11:55969286-55969308 TTAATAAGGCAACAGGATGAAGG - Intergenic
1083257776 11:61507337-61507359 TTGCCAATGCAACGGGAGGAAGG - Intergenic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1084905757 11:72345576-72345598 TTGAAAGGGATACAGGAGGGAGG + Intronic
1086085171 11:82945978-82946000 TTGAGCAGGCACCAGGAGCAGGG + Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1086696355 11:89850850-89850872 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1086702166 11:89911507-89911529 TTGATAAGGCACAAGGAAGAGGG + Exonic
1086704001 11:89932943-89932965 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1086709803 11:89993639-89993661 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1087974310 11:104525539-104525561 TGGAAAAGGCAGCAAGAGGGTGG + Intergenic
1088280360 11:108128741-108128763 TTGAAAAGGCAACTGGAAATGGG + Intronic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089483000 11:118822287-118822309 TGGAAAAGACAAGAGAAGGAGGG - Intergenic
1089739431 11:120572112-120572134 GTGAGAAGACAACAGGAAGATGG - Intronic
1089871198 11:121673825-121673847 GTGAAAAGGCAAGAGGAGCAAGG + Intergenic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091938664 12:4454562-4454584 TTGGAAAGGTCTCAGGAGGAAGG + Intergenic
1091985226 12:4905437-4905459 TTGAGAAAGCAAAAGGAGAATGG - Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092099432 12:5871025-5871047 TTAAAAAAGCAACTTGAGGAAGG + Intronic
1092264990 12:6974088-6974110 CTGAGAGGGAAACAGGAGGAAGG - Intronic
1092286875 12:7133630-7133652 TTGACAAGGCGACAGGAGAGGGG + Exonic
1093349357 12:18079021-18079043 TTGAAAAGGGTAAATGAGGAAGG - Intergenic
1093349711 12:18083136-18083158 TTGAAAAGGGTAAATGAGGAAGG + Intronic
1094340237 12:29402799-29402821 TGTAAAAGGGAACAGGAGGTGGG + Intergenic
1097212625 12:57383995-57384017 TTGGAAAGGCTTCAGAAGGAGGG + Intronic
1097420203 12:59368341-59368363 GAGAAAGGGCAGCAGGAGGAAGG - Intergenic
1097543475 12:60969630-60969652 TTGGAAAGGCCTCAGAAGGAAGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1098284805 12:68896199-68896221 TTGAAAAGGCAAGGGGAGGTTGG - Intronic
1098922615 12:76316147-76316169 ATGAAAAGACAAGGGGAGGAAGG + Intergenic
1098935648 12:76475754-76475776 AGGAGAAGGGAACAGGAGGAAGG + Intronic
1099776062 12:87132792-87132814 TTGGAAAGGCAAACGGAAGATGG + Intergenic
1101120256 12:101571755-101571777 TTGAAAGGGAAAGAAGAGGAGGG - Intronic
1101438314 12:104683084-104683106 TTGAAATGGCAAAAGGGGGCGGG + Intronic
1101838523 12:108311698-108311720 GGCAAGAGGCAACAGGAGGAAGG + Intronic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102474976 12:113182851-113182873 TTGAAAAGACCAAAGGAGGCTGG - Intronic
1102726443 12:115069702-115069724 TTGAAAAGGCAGGAAAAGGAGGG - Intergenic
1105594726 13:21826804-21826826 TTGACAAGACAGCAGGAGAAGGG - Intergenic
1105799006 13:23887245-23887267 TTGAATAGGTAACAAGAGAATGG - Intronic
1106074256 13:26443852-26443874 ATCAAAAGGCAACAGGGGCAGGG - Intergenic
1106807449 13:33325304-33325326 TCCAAAAGGAAACAGGATGAGGG + Intronic
1107113040 13:36718323-36718345 TATAAAAGGCCACAGGAGGCTGG + Intergenic
1107491680 13:40885914-40885936 TTGAAAAGGAAACAGAAAAAAGG - Intergenic
1108394131 13:49976747-49976769 ATGAGAATGCTACAGGAGGAAGG + Intergenic
1109157839 13:58933659-58933681 TTGAAAAGCCAACAGCAGTTGGG - Intergenic
1109956536 13:69575200-69575222 TTAAACTGTCAACAGGAGGATGG - Intergenic
1110967593 13:81719694-81719716 TTAAAATGGCAAAAGGAAGATGG - Intergenic
1112578907 13:100661689-100661711 TTAAAAAGATATCAGGAGGAGGG + Intronic
1114320138 14:21540498-21540520 TTTAAAAAGCAACAGGAGCCGGG - Intergenic
1115287489 14:31731904-31731926 TTGAAAAGGGAACTGGAGGCCGG + Intronic
1115525657 14:34278294-34278316 TTCACAAGGCAACAGGAGAGAGG - Intronic
1115713734 14:36078699-36078721 TTGAAAAGCCAAAAGGATTACGG + Intergenic
1115914473 14:38296192-38296214 TTGAAAAGAAAACATGAGGCAGG + Intergenic
1116544058 14:46140749-46140771 TTGGAAGGGTAAAAGGAGGAGGG - Intergenic
1117919132 14:60709414-60709436 TGGAAAAGGGAAGAAGAGGAAGG - Intergenic
1118062944 14:62160803-62160825 TTTACATGGCAACAGGAGGGAGG - Intergenic
1118571375 14:67199023-67199045 TTCAAAAGGCAAGAAGAGGATGG + Intronic
1118729526 14:68656641-68656663 TTGAAAAGGCGACCGCAGGCCGG + Intronic
1118876410 14:69788460-69788482 GTGAAAAGCCAACAAGAGAATGG + Intronic
1120247263 14:82022026-82022048 TTCACAAGGCAACAGGAGAGAGG + Intergenic
1120334801 14:83141161-83141183 TTGAAAAGGCAAAGGGAATAGGG - Intergenic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1122286365 14:100655040-100655062 CTGCAAAGGCACCAGGAGGGAGG - Intergenic
1202835237 14_GL000009v2_random:73118-73140 TTAAAAAGGTGACAGAAGGATGG + Intergenic
1124141291 15:27079383-27079405 TTTAAAGGACAACAGGAGCAGGG + Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1126722867 15:51600532-51600554 TTGCAAGGTCAACAGGAAGAGGG - Intronic
1127429318 15:58886591-58886613 TTGAAAAGGAAACACAAGTAGGG + Intronic
1127661573 15:61104393-61104415 TTGCAAACACAACAGGAGGATGG + Intronic
1128061149 15:64736766-64736788 CTGCAAAGGTATCAGGAGGAGGG - Intergenic
1128469959 15:67943772-67943794 TTGTAAAGACAATAGGAGCATGG - Intergenic
1128603897 15:69020240-69020262 TTCAAAAGGCAATAGGCTGAAGG - Intronic
1129560951 15:76567828-76567850 ATCAAAAGGCACCAGGAAGAGGG - Intronic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1131809742 15:96160558-96160580 TTAAAAAGGAAACAGCTGGATGG - Intergenic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1132973142 16:2698619-2698641 TTGAGAAGGCACCAGGAGTGGGG + Intronic
1133361415 16:5176870-5176892 TTGCACAGGCAACACAAGGAAGG - Intergenic
1133640514 16:7712545-7712567 TTGAAAAGAGAAAAGGGGGAGGG + Intronic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1137353250 16:47733116-47733138 TGGAAAAGGCAAAAGGAAAAGGG + Intergenic
1137455605 16:48615558-48615580 TAAAAAAGGAAACAGGAGGAAGG - Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1138922273 16:61546219-61546241 TTGATAAGACAAGAGAAGGAAGG + Intergenic
1139115319 16:63944166-63944188 TCGAAAAGGCAAAAAGAAGAAGG - Intergenic
1139997584 16:70995473-70995495 TTGAAAATAAAACATGAGGAGGG - Intronic
1140066287 16:71614261-71614283 TTGGAAAGGGCACAGTAGGAAGG + Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1143004371 17:3818726-3818748 CTGATACTGCAACAGGAGGATGG + Intronic
1143100932 17:4504344-4504366 TTGAAAAGGAAGCAGGAGCAAGG - Intronic
1146139966 17:30357266-30357288 CTGAGAAGGCAGCAGGGGGATGG + Intergenic
1146206570 17:30910043-30910065 TTTAAAAGGAAACAGGAGGCTGG + Intronic
1146669959 17:34730394-34730416 TTGAGGAGCCAACAGGAAGAAGG + Intergenic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1148041419 17:44710230-44710252 TTTAAAAGGCAACAAGCCGATGG - Intronic
1149023108 17:51992861-51992883 TTGAAAAGGAAACAGCAAGTTGG - Intronic
1149970100 17:61209469-61209491 TTATAAAGGCAAGGGGAGGAGGG + Intronic
1150213588 17:63454872-63454894 ATGAGAAGCCAACAGGAGGAGGG + Intergenic
1150645339 17:66974395-66974417 TTGAAAAGGCAGCATGGGGTAGG + Intronic
1150873237 17:68939096-68939118 TGGTAATGGTAACAGGAGGATGG - Intronic
1151365721 17:73614788-73614810 TTGAAAAGGGGAAAGGAGGGAGG + Intronic
1152145990 17:78569204-78569226 TGGAAAAGGCAAGAGAAGAAGGG + Exonic
1152244949 17:79180570-79180592 AGGTAAAGGCCACAGGAGGAGGG - Intronic
1153444753 18:5158513-5158535 ATGCAAAGGGAAGAGGAGGAGGG - Intronic
1154427929 18:14286207-14286229 TTAAAAAGGTGACAGAAGGATGG + Intergenic
1154430644 18:14305721-14305743 TTAAAAAGGTGACAGAAGGATGG + Intergenic
1156493736 18:37512158-37512180 TTCCAAGGGCCACAGGAGGAGGG - Intronic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1159135132 18:64328593-64328615 ATGAAAAGGCAACAGAGGCATGG + Intergenic
1159476766 18:68930832-68930854 TTGAAAAGTAAACAGGAATAAGG + Intronic
1160145891 18:76364045-76364067 TTCCAGAGGCAACAGGAAGACGG + Intronic
1161890554 19:7032998-7033020 TTTGAAAGGCAACAGGTGTAAGG + Exonic
1161890897 19:7037735-7037757 TTTGAAAGGCAACAGGTGTAAGG - Exonic
1161892639 19:7051726-7051748 TTTGAAAGGCAACAGGTGTAAGG + Exonic
1161892980 19:7056196-7056218 TTTGAAAGGCAACAGGTGTAAGG - Exonic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1164732522 19:30517069-30517091 TCAAAAAGGCCCCAGGAGGAAGG - Intronic
1165194474 19:34090870-34090892 TTGAGAAGGCAAGAGGGGAAAGG + Intergenic
1166264556 19:41670873-41670895 ATGAGAAGGAAATAGGAGGAGGG - Intronic
1166397935 19:42456156-42456178 ATGAGAAGGAAGCAGGAGGAGGG - Intergenic
1166437704 19:42783125-42783147 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166456652 19:42946923-42946945 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166486401 19:43217417-43217439 TTGAAAAGGAAAAAGGAAGCTGG + Intronic
1166493516 19:43280844-43280866 TTGAAAAGGAAAAAGGAAGCTGG + Intergenic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167770233 19:51510262-51510284 TAGAAAAATCCACAGGAGGACGG - Intergenic
1202637389 1_KI270706v1_random:54231-54253 TTAAAAAGGTGACAGAAGGATGG - Intergenic
926395885 2:12441804-12441826 TTGAGCAGGTAACAGGAGGAAGG + Intergenic
926820501 2:16846952-16846974 TTGAAAAGAGAAGAGGAAGAAGG + Intergenic
926889405 2:17626385-17626407 TGGAAAAGGTGACAGGAGTAGGG + Intronic
927230240 2:20815986-20816008 TTAAAAAGGGAAAAGGAGAAAGG + Intronic
927331623 2:21871269-21871291 TTCACAAGGCAACAGGAGAGAGG - Intergenic
928611082 2:32993123-32993145 TGGAAAATGCAGCATGAGGAGGG + Intronic
929428933 2:41870593-41870615 TGGAAAAGGTAATATGAGGAAGG - Intergenic
931373746 2:61688866-61688888 TTGATAATGCTCCAGGAGGAGGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
932338187 2:70943048-70943070 GTGAAAAGGCAAGGGAAGGAGGG - Intronic
932401462 2:71483453-71483475 TTGAAAAGGCCAGAAGGGGAGGG + Intronic
932472970 2:71975180-71975202 ATGACCAGGCAACAGGAGAAAGG + Intergenic
932600837 2:73124246-73124268 TTAAAAAGATAACAGGAGGTAGG - Intronic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
935353611 2:102177692-102177714 TTAAAAAAGCAACAGTAGCAGGG + Exonic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
938908496 2:135862678-135862700 TTCCAAAGACAACAGGAGAAGGG - Exonic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939238363 2:139526674-139526696 CTAAAAAGGCAAGAAGAGGAAGG + Intergenic
939549560 2:143597539-143597561 TTGAGAAGGGAACAATAGGAGGG - Intronic
940014150 2:149085974-149085996 TACTAAAGGCAACAGGAGAAAGG + Intronic
940019457 2:149141629-149141651 TTGATAATCCAACAGGAGGTTGG - Intronic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
942570681 2:177311037-177311059 TTCACAAGGCAGCAGGAGGGAGG + Intronic
944389088 2:199198522-199198544 TAGAATAGTCAACAGGAGCAGGG - Intergenic
944912664 2:204325642-204325664 TTGCAAAGGCTACAGGAGATCGG + Intergenic
945420000 2:209623284-209623306 TAAAAAAGGCAGCAGCAGGATGG + Intronic
945882146 2:215336527-215336549 TTCAAAAGGTAACAGAAGGATGG - Intronic
946322931 2:218963976-218963998 CTGAGAAGGCAAGGGGAGGAGGG + Intergenic
946816358 2:223582426-223582448 TTGAAAAGCCAGCAGGACAAGGG - Intergenic
946913914 2:224495959-224495981 TTAAAAATGAAACAGGAAGATGG - Exonic
949011207 2:241679670-241679692 TTGAAAATGCATCTGGAGGCTGG + Intronic
1171437545 20:25134930-25134952 TTGAAATGGAGACTGGAGGACGG - Intergenic
1171511335 20:25686869-25686891 TTGAGAAGGCCACAGGCAGATGG + Exonic
1171883970 20:30638325-30638347 TTAAAAAGGTGACAGAAGGATGG - Intergenic
1174191307 20:48742641-48742663 TTGATGAGGCTACATGAGGAGGG + Intronic
1174732626 20:52932704-52932726 TTGAAAAGGCAAGCGAGGGAAGG - Intergenic
1175592981 20:60207999-60208021 TTGAAAAGGCAAAAGGTGAACGG - Intergenic
1175672720 20:60919955-60919977 TGGAAAAGGAGAGAGGAGGAGGG - Intergenic
1175706980 20:61186667-61186689 TGGAAAAGGCAGGAGGATGAGGG - Intergenic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1175759109 20:61549393-61549415 TTGAACAGACACCAGCAGGATGG - Intronic
1176846839 21:13883217-13883239 TTAAAAAGGTGACAGAAGGATGG - Intergenic
1177343323 21:19834596-19834618 TGGAAAAGGGAAGAAGAGGAGGG - Intergenic
1177549945 21:22607685-22607707 TTAAAAAAGCAACATGAGGCCGG + Intergenic
1178348661 21:31854131-31854153 TAGAAAGGGCACCATGAGGATGG + Intergenic
1178754070 21:35331241-35331263 ATGAAAAGGCAAAAGTAGCAAGG - Intronic
1179279988 21:39925796-39925818 GTGACAAGGCCACAGGAGCAGGG - Intronic
1179321470 21:40295819-40295841 TTGGAAAGGCCACAGAGGGATGG - Intronic
1179326532 21:40351822-40351844 TTGAGAAGGAGACAGGAGAATGG + Intronic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180136926 21:45867993-45868015 CTGAAGAGGCCACAGGAGGCTGG + Intronic
1180635247 22:17258545-17258567 TGGAAATGGCCTCAGGAGGAGGG - Intergenic
1180839872 22:18954293-18954315 TGGGAGAGGCAACAGCAGGAGGG - Intergenic
1181062024 22:20286186-20286208 TGGGAGAGGCAACAGCAGGAGGG + Intergenic
1184487914 22:44792304-44792326 CTGAAAAAGCAACTGGAGGCCGG - Intronic
1184702854 22:46188483-46188505 TTGCAAAGGCAGCATGATGAGGG - Intronic
1184831750 22:46993252-46993274 TTGTAATGGCAACAGGTGTAAGG + Intronic
1185263246 22:49882771-49882793 TTGAATGGGTGACAGGAGGATGG + Intronic
1185311866 22:50160546-50160568 TTCAAAAAGAAACAGGAGGCCGG - Intronic
950504348 3:13384967-13384989 ATGTCAAGTCAACAGGAGGATGG - Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951617669 3:24566556-24566578 TTAGTAAGACAACAGGAGGAAGG - Intergenic
953131340 3:40142347-40142369 TTGAAAAATCAACAGCAGGCCGG - Intronic
953185109 3:40630294-40630316 TTCACAAGGCAGCAGGAGGTGGG - Intergenic
955864542 3:63369191-63369213 GTGAAGAGGCAACAAGAGGGTGG + Intronic
958418502 3:93905769-93905791 TTGTAAAGGTAAGAGCAGGATGG - Exonic
959477201 3:106825189-106825211 TTGACAAGGCTACTGAAGGAGGG + Intergenic
959675132 3:109026219-109026241 TGCAAAAGGAAAAAGGAGGATGG + Intronic
959715803 3:109431525-109431547 TGGAAAAGGCCACAGGGAGAAGG - Intergenic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960684195 3:120280615-120280637 TTATGAAGGCCACAGGAGGATGG - Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961448155 3:126990773-126990795 TTGAAAAGCCAAGGGGAGGGTGG - Intronic
961600957 3:128061754-128061776 GTGAAAAGGCAAGAGGGGGATGG + Intronic
962262535 3:133922763-133922785 ATAAAAGGGCAACAGGAGGCTGG + Intergenic
962436465 3:135371650-135371672 TTTAAAGGGCAATAGGAGGAGGG - Intergenic
963227842 3:142880665-142880687 TTGATCAGGCATCTGGAGGATGG + Intronic
963823411 3:149924869-149924891 TTGAGAAGGCAAGAGGAGATTGG + Intronic
964022871 3:152035214-152035236 ATGAAAAGGAAATAGGGGGAGGG + Intergenic
964703135 3:159591018-159591040 TTTAAAAGAAAACAGGATGAGGG - Intronic
966058882 3:175731832-175731854 TTAAAAAAGAAAAAGGAGGAGGG - Intronic
966845284 3:184124268-184124290 TTGAAAAGGTAAAAGGTGGGGGG + Intergenic
967361384 3:188635976-188635998 TTGAAAAGGAAATTGAAGGATGG + Intronic
967444784 3:189554525-189554547 TTGCAGAGACAACAAGAGGATGG - Intergenic
968428372 4:537750-537772 TGGAGAAGCCAAGAGGAGGATGG + Intronic
968718737 4:2182384-2182406 GGGAAAAGGCCACATGAGGATGG + Intronic
969064048 4:4463134-4463156 TTGCAAAGCCAACAGTGGGAGGG - Intronic
969377997 4:6775818-6775840 TTGAAAAGGACACATGAGCAGGG + Intergenic
970275789 4:14399156-14399178 TAGAAAAGGCAAAAGACGGAGGG + Intergenic
970768081 4:19575610-19575632 TTGAAAAGGGAAAAGGGGAAGGG + Intergenic
972438834 4:39063736-39063758 GTGAAAAGGGGACAGGAAGAAGG + Intronic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973056332 4:45663971-45663993 TTGCAAAAGCAACTGAAGGAGGG - Intergenic
973367637 4:49220599-49220621 TTAAAAAGGTGACAGAAGGATGG - Intergenic
973393414 4:49574833-49574855 TTAAAAAGGTGACAGAAGGATGG + Intergenic
974189319 4:58483494-58483516 GTGGAAAGGCAACAGCAGTAGGG + Intergenic
976001706 4:80381871-80381893 AGGAAAAAGGAACAGGAGGAAGG - Intronic
976238735 4:82930592-82930614 TGGAAAAGGCAAGAGAAGGTAGG + Intronic
976384435 4:84439248-84439270 TTGAAAAAGCACCTGGAGGTTGG - Intergenic
976963183 4:91003787-91003809 GGGAAAAGGCCACAGAAGGAAGG - Intronic
977525133 4:98135781-98135803 TTGAAAAGGCAACAGTTGTCTGG + Intronic
977685906 4:99847642-99847664 AGAAAAAGGCAACAGGAGGCAGG - Intronic
977989929 4:103429387-103429409 CTGAAAAGGAAACCGGAGGAAGG + Intergenic
978465099 4:109000184-109000206 TTAAAGAGGAAACTGGAGGAAGG + Intronic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
979148541 4:117277985-117278007 GTGGAAAGGCAACAGAAGAATGG + Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
980195132 4:129578498-129578520 TGGAAAAAGCCACAGGAAGAAGG - Intergenic
980502077 4:133669026-133669048 TTCAAAAGAAAATAGGAGGAGGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980773921 4:137414956-137414978 TTGATTAGGCAAGAGGATGACGG - Intergenic
981291189 4:143078044-143078066 TTCAACAGGCAACAGGGGGCAGG - Intergenic
981676912 4:147353255-147353277 TTGTAAAAGAAACAGGGGGATGG - Intergenic
982130428 4:152224281-152224303 TAGAGAAGGCAAAAGGTGGAGGG + Intergenic
982764339 4:159326762-159326784 AAGAAAGGGCAACAGGAGAAGGG - Intronic
983321665 4:166202872-166202894 ATGAAAAGGAAACAAGGGGAGGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
1202764706 4_GL000008v2_random:140087-140109 TTAAAAAGGTGACAGAAGGATGG - Intergenic
986307261 5:6524967-6524989 TTGGAACGGCCACAGGAGAAAGG + Intergenic
986904291 5:12475092-12475114 TTGAAAAGTTAACAGTAGGATGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
988970312 5:36460288-36460310 TAGACAAGGCAAAAGGGGGAAGG + Intergenic
989321607 5:40141302-40141324 TGAAAAAGGCAAAAAGAGGAAGG + Intergenic
990889855 5:60635985-60636007 CAGAAAAGGCTACAGGAGCAGGG - Intronic
990999975 5:61772809-61772831 TTGTAAAGGCAAAAAGAGCATGG - Intergenic
991610087 5:68440834-68440856 TTGAAGAGGCCAGAAGAGGATGG - Intergenic
991624266 5:68582975-68582997 ATGAGGAGGCAACAGCAGGAAGG + Intergenic
992035491 5:72770643-72770665 TTGAACAAGCACCAGTAGGAGGG - Intergenic
992133645 5:73720549-73720571 GGGAAAATGCAAGAGGAGGAAGG + Intronic
993914061 5:93720011-93720033 TTGAAAAGGAAACGGCATGACGG - Intronic
994294283 5:98070573-98070595 TTGAAAACACAACAGCAAGATGG - Intergenic
994343279 5:98656994-98657016 TTGAAAAGACAACTGCAGGGAGG + Intergenic
995558170 5:113352272-113352294 TTCAAAGGGCAAAAGGAAGATGG - Intronic
996806749 5:127464098-127464120 GTGAAAAGACAACAGAATGAGGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997371708 5:133365700-133365722 TTGAAAAGGTCACAGCAGTACGG - Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
998172461 5:139880723-139880745 TTGATATGGCAGCAGCAGGAGGG + Intronic
999983602 5:156981700-156981722 TTGAAAAGAAAAGAGGAAGAGGG + Intergenic
1000335346 5:160237848-160237870 TGGAAAAGCAAACAGGAGAAAGG - Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002073963 5:176697207-176697229 ATGAAAATGCAACCGGATGATGG - Intergenic
1002408708 5:179056233-179056255 TTAAAAAGGGAACAGGAACATGG - Intergenic
1003088058 6:3077262-3077284 ATGAAAAGGAAACAGGAGGATGG + Intronic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1006144930 6:31953148-31953170 TAGCAAAGGAGACAGGAGGAGGG - Intronic
1008111834 6:47503360-47503382 GTGAAAAAGCTACAGGAGGAAGG + Exonic
1008131569 6:47725265-47725287 TGAAAGAGGCAACAGGAGAAAGG + Intergenic
1008225446 6:48909470-48909492 CTAAAAAGACAACAGGAGCAGGG - Intergenic
1008450805 6:51648120-51648142 TAGAAATGGGAATAGGAGGAGGG + Intronic
1008528694 6:52434245-52434267 GGGAAAAGGCCACAGGAAGAAGG - Intronic
1009901843 6:69816793-69816815 TTGAAAAGGCAACAGAAAGACGG - Intergenic
1010566949 6:77427793-77427815 TTAAAAAGATAATAGGAGGATGG + Intergenic
1010949440 6:82017607-82017629 TTCAATAGGCAACAGGAGAAGGG + Intergenic
1011038090 6:82999679-82999701 TTTAAAAGCCAACAGGGGGCTGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012094474 6:94941644-94941666 GTGAAAAGACAACATGTGGAAGG + Intergenic
1012243357 6:96898448-96898470 TTGAAAATGCATCAGGCGGGGGG - Intergenic
1012903676 6:105038342-105038364 ATGAAAAGGGAACTGGAAGAGGG + Intronic
1012993731 6:105951970-105951992 TTTAAAAGGCTACATGAGGCTGG + Intergenic
1013073202 6:106747788-106747810 TTTAAAAGAGAAAAGGAGGATGG + Intergenic
1013477460 6:110522034-110522056 TTTAAAAGGGAACAGGAGGCCGG - Intergenic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1014288739 6:119534075-119534097 CTGCAAGGGCTACAGGAGGATGG - Intergenic
1015457655 6:133445874-133445896 TTGAAAAGGAAACTAGAGGCCGG - Intronic
1015511294 6:134040534-134040556 AGGAAACGGGAACAGGAGGATGG - Intronic
1015675208 6:135738522-135738544 TTGACAAGGGAACAAGATGAAGG - Intergenic
1016422749 6:143901762-143901784 TGGAAAAGGCTACTGGAGAAGGG - Intronic
1016730040 6:147419153-147419175 ATGAAAAGACAACAGGAGTTTGG - Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017149193 6:151262863-151262885 TTGAAAAAAGAACAGCAGGAGGG - Intronic
1017447743 6:154523648-154523670 TTTAAGAGGCAACAGCAGGCAGG + Intergenic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1017790954 6:157799079-157799101 TTCACAAGGCAGCAGGAGGGAGG + Intronic
1018757238 6:166860834-166860856 TTGAAATGGCAACCGCAGTAAGG + Intronic
1020358639 7:7303857-7303879 GGGAAAAGGGAACAGGAAGAAGG - Intergenic
1022459296 7:30589058-30589080 TTTTAAAGGCAACAGGGAGAAGG - Intergenic
1022562987 7:31369297-31369319 CTGAAAAGGAGACAGGAGGTAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022991663 7:35714627-35714649 AAGAGAAGGCAACAGGAGGCAGG + Intergenic
1023464002 7:40433550-40433572 TTCAAAAGGAAACAGGAAGGTGG - Intronic
1023518942 7:41031600-41031622 AGGAAAAGCCAACAGGAGGTAGG - Intergenic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1024360447 7:48462448-48462470 TTGATAAGGAAACAGTAGGGGGG - Intronic
1024404918 7:48967913-48967935 TTGCAAAGGGAAGAGGAGAAAGG + Intergenic
1025794832 7:64729757-64729779 TGGAAAAGACCACAAGAGGAAGG - Intergenic
1027708474 7:81566937-81566959 TGGAAAAGGCAACATTTGGATGG - Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1028615345 7:92759657-92759679 TTCAAAAGGCCACAGTAGGATGG + Intronic
1029615233 7:101652306-101652328 TTGAAAAGCCAACTGTAGGCTGG + Intergenic
1030114549 7:106053459-106053481 TTGAAAAGGCAAGACAAGGAGGG - Intergenic
1030364745 7:108632577-108632599 TAGAAAAGACAATAGAAGGAAGG + Intergenic
1030621872 7:111798840-111798862 TTCAAATGGCAACATGAGCATGG - Intronic
1031594645 7:123635029-123635051 TTGAAAAGACAAAAAGGGGATGG + Intronic
1031730625 7:125295956-125295978 GTGAAAAGGCAACCTAAGGAAGG + Intergenic
1032124861 7:129186350-129186372 TACATAAGGCAACATGAGGATGG - Intergenic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1032859276 7:135862186-135862208 TTGAATAGAGAACAGGATGAAGG - Intergenic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033152559 7:138928215-138928237 TTGAAAAGACAATAGTAGGCCGG - Intronic
1033556673 7:142494133-142494155 ATGAACATGCAACAGGAGCAAGG + Intergenic
1034015785 7:147584780-147584802 TTGAAGAGGCTACAGCAGGCAGG + Intronic
1034035746 7:147819310-147819332 TGAAAAAGGCAACATCAGGAAGG - Intronic
1034285937 7:149882955-149882977 TTGAAATGGCATCATCAGGAAGG - Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035325913 7:158065918-158065940 TTTAAAAGGGAAGAGGTGGATGG + Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037883534 8:22584798-22584820 CTGAGAAGGCAACAGAGGGAGGG - Intronic
1038253852 8:25932067-25932089 TTGAGAAGCCACCAGGAGAAGGG + Intronic
1038846131 8:31231085-31231107 TGGAAGAGGCAATGGGAGGATGG + Intergenic
1039915004 8:41853364-41853386 TCGCAAAGGCAAAAGAAGGAGGG + Intronic
1040051964 8:43023754-43023776 TCGAAAAGGAAATAGGAGGCTGG - Exonic
1042708165 8:71684354-71684376 TTTCAAAGGCAACAGAAGTAAGG - Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1043714315 8:83462163-83462185 TTGAAAAGGCCAGAGAAAGAAGG - Intergenic
1043973900 8:86563915-86563937 TAGAAAAGGAAAGAGCAGGAGGG - Intronic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045137468 8:99236752-99236774 TTAAAAAGGCAAATGGAGAATGG + Intronic
1045167980 8:99628456-99628478 AGGAAAAGGGAACAGGAGGCAGG - Intronic
1045402958 8:101836775-101836797 TTAAAAAGGCAAAATGAGGTTGG + Intronic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1045832014 8:106473343-106473365 TTTCAAAGGCACCAGGAGAAAGG - Intronic
1045839996 8:106568580-106568602 AGGAAAAGGGAACAGCAGGAGGG - Intronic
1045956529 8:107914640-107914662 TTGAAAATTCTAAAGGAGGAAGG - Intronic
1047281540 8:123450373-123450395 TTCAGGAGGGAACAGGAGGAAGG + Intronic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1050004674 9:1117869-1117891 ATTAAAAGGCAATAGTAGGATGG - Intergenic
1051451983 9:17207161-17207183 TTGCAATGGAAACAGGAGAAGGG - Intronic
1051687749 9:19675923-19675945 TGGAAAAGACCACAGGAAGAAGG - Intronic
1051898486 9:22013057-22013079 GTGAAGAGGCAGCAGTAGGATGG - Intronic
1052575441 9:30283976-30283998 TTGCTCAGGCAACATGAGGAAGG - Intergenic
1052803391 9:32990699-32990721 TTTAAAAGGCTTCACGAGGAAGG + Intronic
1054156615 9:61645163-61645185 TTGAAATGGCAACAGGGCAATGG - Intergenic
1054701584 9:68418522-68418544 CTGAAAAGGCGACAGGAGAAAGG + Intronic
1054845597 9:69793695-69793717 TTGAGAAAGAAACAGAAGGAAGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055209901 9:73779225-73779247 TTCACCAGGCAGCAGGAGGAGGG - Intergenic
1055692548 9:78848125-78848147 TTGAAAAGGCACAATGGGGATGG + Intergenic
1055736200 9:79334054-79334076 AGGAAAAGGCCACAGGAAGAAGG + Intergenic
1055848881 9:80600928-80600950 TTGAAAATCCAACACTAGGAAGG - Intergenic
1056176467 9:84041479-84041501 TTGAAAAAAGAACAGGAGGCCGG + Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057115019 9:92512892-92512914 GTGTATAGGCCACAGGAGGAAGG + Intronic
1057676454 9:97139789-97139811 TTAAAAGGGCGACAGAAGGATGG - Intergenic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1059182947 9:112236879-112236901 TAAAAAAGGCAAGTGGAGGATGG + Intronic
1059398628 9:114054720-114054742 CTGAAAAGGCAAAACCAGGAGGG - Exonic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1060994664 9:127869171-127869193 TTGGAAAGGCAAGAGGAATAAGG + Intronic
1203545455 Un_KI270743v1:124975-124997 TTAAAAAGGTGACAGAAGGATGG - Intergenic
1185782230 X:2858801-2858823 TTAAAAAGGCTCCTGGAGGATGG + Intronic
1187552911 X:20323912-20323934 TTTAAAAGGCAATGGGAGGTGGG - Intergenic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189863719 X:45300924-45300946 TTGAAAAGGAAAAGGGAAGATGG + Intergenic
1190828628 X:54041471-54041493 TCTAACAAGCAACAGGAGGAGGG + Intronic
1190842191 X:54155537-54155559 TTGAAAAGCAAACAGGGGAAGGG + Intronic
1192319799 X:70081282-70081304 TGACTAAGGCAACAGGAGGATGG + Intergenic
1193796052 X:85875105-85875127 TTGAAAAGAAACCATGAGGAAGG + Intronic
1194247067 X:91528147-91528169 TTGAAAAGCCAATATGAAGATGG + Intergenic
1194655490 X:96568550-96568572 TAGAAATGGAAACAGGAGGATGG + Intergenic
1194890634 X:99373563-99373585 TTGAAAAGGAGACAAGAGTATGG + Intergenic
1195282227 X:103347730-103347752 TGAAAAAGGAAACAGAAGGAGGG - Intergenic
1196655428 X:118212650-118212672 TTTAAAAGGCAACAGAAGCTGGG + Intergenic
1196948484 X:120851975-120851997 GTGAAAAGGAAACAGGTAGAAGG - Intergenic
1197182821 X:123554356-123554378 TTCCACAGGCAACAGGGGGAAGG + Intergenic
1198279752 X:135130071-135130093 TTGAACAGGCCGCATGAGGATGG - Intergenic
1198291205 X:135242443-135242465 TTGAACAGGCCGCATGAGGATGG + Intergenic
1198433060 X:136587396-136587418 GTTAAAAGGAAACAGGAGAAAGG + Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200566088 Y:4769685-4769707 TTGAAAAGCCAATATGAAGATGG + Intergenic
1201746788 Y:17384632-17384654 GTGACAAGGCAAAAGGAGTAAGG + Intergenic