ID: 1097625688

View in Genome Browser
Species Human (GRCh38)
Location 12:61997465-61997487
Sequence CAGTGGAAAGAGAGGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097625688 Original CRISPR CAGTGGAAAGAGAGGCCCAG TGG Intronic
900536303 1:3179397-3179419 CTGGGGAAACAGAGGCACAGGGG - Intronic
900646969 1:3713378-3713400 AGGGGGAAAGAGAGGCCCACAGG + Intronic
900717898 1:4156903-4156925 CAGAGGAGAGAGAGGCCTGGAGG - Intergenic
900917494 1:5649060-5649082 CTGAGGAAACCGAGGCCCAGAGG - Intergenic
900970607 1:5990733-5990755 AAGGGAGAAGAGAGGCCCAGAGG + Intronic
901493123 1:9606692-9606714 CAGAGGGAAGAGAGGGACAGAGG - Intronic
901634980 1:10666331-10666353 AAATGGACAGAGAGGCCAAGAGG - Intronic
901716662 1:11160785-11160807 CAGTTGAAATAGAGTCCCGGAGG + Intronic
901807257 1:11746489-11746511 CAGGGGAAGGCAAGGCCCAGTGG + Intronic
901853729 1:12031334-12031356 CAGCGGAGACAGAGGACCAGAGG - Exonic
902043180 1:13506982-13507004 CAGTGGACAGATAGCCCCAGGGG - Intronic
902051639 1:13567927-13567949 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051649 1:13567971-13567993 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051659 1:13568015-13568037 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051669 1:13568059-13568081 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902051679 1:13568103-13568125 GAGGGGAAAGAGAGGCAGAGGGG + Intergenic
902422170 1:16289524-16289546 CAGGGGAGAGAGTGGCACAGGGG - Intronic
902483573 1:16725922-16725944 CAGAGTAAAGCGAAGCCCAGCGG - Intergenic
902637387 1:17743511-17743533 AAGTGGACAGATAAGCCCAGAGG - Intergenic
902735069 1:18395154-18395176 CAGAGAAAACTGAGGCCCAGAGG + Intergenic
902763827 1:18601690-18601712 ATGTGGAAACTGAGGCCCAGAGG - Intergenic
903278598 1:22237234-22237256 CAAAGGAAACTGAGGCCCAGAGG - Intergenic
903426289 1:23256823-23256845 CCGTGGAAAGAGAGGGAGAGGGG - Intergenic
903594814 1:24485900-24485922 ATGAGGAAACAGAGGCCCAGAGG - Intergenic
903623269 1:24713536-24713558 CAGTGGCAAGCCAGGGCCAGAGG + Intergenic
903715295 1:25361320-25361342 CCTTGGAATGAGAGGCACAGCGG - Exonic
904268657 1:29333619-29333641 CATTGGCAAGGGAGGCTCAGAGG - Intergenic
904531910 1:31175820-31175842 CCGTGGAAAGAGAGGGAGAGGGG - Intergenic
904853273 1:33475517-33475539 TAGTGGAAAGAGAGGCACGAGGG + Intronic
905561057 1:38927648-38927670 CTGAGGAAACTGAGGCCCAGTGG - Intronic
905771157 1:40638839-40638861 AAGAGGAAACTGAGGCCCAGCGG + Intronic
906295749 1:44648078-44648100 CAGCAGAAACAGAGGCCAAGAGG - Intronic
906374282 1:45282072-45282094 CAGTGTATGGAGAGGCACAGAGG - Intronic
906708595 1:47912883-47912905 CAGTGGGAAGAAAGGACCTGTGG + Intronic
907422818 1:54358579-54358601 CAGGGGATACTGAGGCCCAGGGG - Intronic
907524673 1:55047145-55047167 CAGTGGAAAGAAAGGCCTAGAGG - Intronic
909516569 1:76514433-76514455 CACTGGAAAGTGGGGCCTAGTGG + Intronic
910106591 1:83637885-83637907 GAGAGGAAAGTGAGGCTCAGAGG - Intergenic
912623689 1:111190675-111190697 AATGGAAAAGAGAGGCCCAGCGG - Intronic
913047209 1:115084565-115084587 AGGTGGAAAGAGAGTACCAGGGG - Intronic
915584711 1:156838150-156838172 CTCTGGGGAGAGAGGCCCAGAGG - Intronic
916459569 1:165009421-165009443 CAGTGGCAAGAGAGGCCACTGGG - Intergenic
916601862 1:166300955-166300977 AAGTGGACAGAGACACCCAGCGG - Intergenic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
918045874 1:180940878-180940900 CTGTAGAAAGAAAGGCCAAGTGG - Intronic
919268508 1:195306259-195306281 CACTGGAAAAAGAGGCATAGTGG + Intergenic
920387022 1:205576450-205576472 CAGAGGAAACTGAGGCTCAGAGG + Intronic
920524938 1:206659517-206659539 TGGTGGACAGGGAGGCCCAGTGG + Intronic
921266077 1:213421617-213421639 CAGGGGTAAGAGAGGCTGAGGGG - Intergenic
921440770 1:215182932-215182954 CAGTGGAAGGTGAGTCACAGAGG + Intronic
922291318 1:224211073-224211095 CACTGGAAAGAAAGGCCCATAGG + Intergenic
922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG + Intronic
923337700 1:232984720-232984742 CGCTGGAAAGAGCGGCCCTGGGG + Intronic
924800658 1:247327821-247327843 CAGTGGAAAGAGAGTGTCTGGGG - Intronic
1063081036 10:2767342-2767364 CAGTAAAAACAGAGACCCAGGGG - Intergenic
1063460782 10:6213833-6213855 CAGGGGACAGAGGCGCCCAGGGG - Intronic
1063488903 10:6445288-6445310 CAGTGCTAAGTGAGGCCCAGGGG + Intronic
1064320038 10:14296429-14296451 CACTGGAAGGACAGGCCCAGAGG - Intronic
1064534632 10:16346043-16346065 CAGTGGCAAAAGAGGCAGAGTGG + Intergenic
1065731162 10:28710972-28710994 CACTGGTAAGAGATGCCTAGAGG + Intergenic
1067064588 10:43096616-43096638 CTGGGGAAACTGAGGCCCAGAGG + Intronic
1068653409 10:59549008-59549030 AAGAGGAAACTGAGGCCCAGGGG - Intergenic
1068814146 10:61291030-61291052 GAGTGGTAGGAGGGGCCCAGGGG + Intergenic
1069583244 10:69579108-69579130 CAGAGGAGAAACAGGCCCAGAGG - Intergenic
1069827435 10:71262760-71262782 CTGTGCCAAGTGAGGCCCAGGGG - Intronic
1069857349 10:71448691-71448713 CATTGGAAAGATGAGCCCAGTGG + Intronic
1069995625 10:72340629-72340651 GAATGGCAAGGGAGGCCCAGAGG + Intronic
1070279012 10:75035370-75035392 GAGTGGAAGGAGAGGGGCAGAGG - Intergenic
1070559348 10:77554052-77554074 GAGTGGAAGGAGAAGCCCACAGG + Intronic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1072034540 10:91552229-91552251 GAGTGGACACAGAGGCCAAGAGG + Intergenic
1072573500 10:96678713-96678735 CAGTGGGCACAGAGGCTCAGAGG - Intronic
1072581059 10:96740513-96740535 CAGAGGCGAGAGAGTCCCAGAGG - Intergenic
1072691549 10:97575285-97575307 GAGGGGAAAGAGGGCCCCAGAGG + Intronic
1072730178 10:97841020-97841042 CCGTGGAAAGAGAGGGAGAGGGG - Intergenic
1073466761 10:103698804-103698826 CAGAGAAAAGAGAGGTCCTGGGG + Intronic
1073602568 10:104861342-104861364 CATGAGAAAGTGAGGCCCAGAGG - Intronic
1073955214 10:108862803-108862825 CAGAGGACAAAGAGGCCCTGTGG - Intergenic
1074127046 10:110536703-110536725 AAGTGGAAAGAAATGCCAAGGGG + Intergenic
1074399475 10:113129906-113129928 GAGTGGTAAGGGAGGCGCAGTGG + Intronic
1075108726 10:119560495-119560517 CCGTGGAAAGAGAGGGGGAGGGG + Intergenic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075574913 10:123571203-123571225 CAGTGGGAAGAGAGGCCCCATGG - Intergenic
1076080433 10:127575716-127575738 CAGGTGAAAGAGATGACCAGAGG + Intergenic
1076167464 10:128293997-128294019 CAGAGGACAAACAGGCCCAGGGG + Intergenic
1076696498 10:132249750-132249772 CAGTGGAACTGGAGACCCAGTGG + Intronic
1077148492 11:1056637-1056659 CAGTGGGAAGAGAGGCCCCTGGG - Intergenic
1077301047 11:1847143-1847165 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
1078106557 11:8361557-8361579 CAGTGCAACGAAAGGTCCAGAGG - Intergenic
1078403929 11:11052091-11052113 CAATGAAAGGAGAGGCCCAGCGG - Intergenic
1078859669 11:15235461-15235483 CCGTGGAAGGATAGGCCCGGTGG + Intronic
1079002164 11:16767223-16767245 CAGAGGAAAAAGTGGCCGAGAGG - Intergenic
1079111205 11:17606165-17606187 CAGTGGACTGAGAGGGCCAAAGG - Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1080937029 11:36875036-36875058 CACTGCCAAGAGAAGCCCAGAGG + Intergenic
1081050215 11:38330784-38330806 CTGTGGAAAGTGTGGCTCAGCGG + Intergenic
1081182725 11:40003900-40003922 CAGTGGAAAGAGATGCCTATGGG + Intergenic
1081612220 11:44569335-44569357 CAGTGGAAGGGGAAGCCCGGGGG - Intronic
1081653274 11:44839788-44839810 CAGAGGACAGAGAAGGCCAGTGG + Intronic
1082756297 11:57079874-57079896 CAGTGTGAAAAGAGGCCCAGAGG - Intergenic
1083105032 11:60349190-60349212 CAGATGAAAAAGAGGCTCAGAGG + Intronic
1083301676 11:61742815-61742837 CAGTGGAATGAGAGAGACAGAGG - Intronic
1083348771 11:62012590-62012612 CAGTGCAGTGGGAGGCCCAGAGG - Intergenic
1083399993 11:62416936-62416958 GAGGGGGAAGAGAGGCCCATGGG + Intronic
1084456138 11:69269163-69269185 CAGGGGAGAGAGAGGTCCAGTGG + Intergenic
1086063111 11:82720648-82720670 CAGGGGATAAAGTGGCCCAGAGG - Intergenic
1086118445 11:83280401-83280423 CAGATAAAAGAGAGGCTCAGAGG - Intronic
1086895455 11:92307082-92307104 AAGTGGAAAGCCAGGCACAGTGG - Intergenic
1087684330 11:101245981-101246003 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684333 11:101246015-101246037 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684338 11:101246070-101246092 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684343 11:101246125-101246147 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684365 11:101246360-101246382 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1088249402 11:107849842-107849864 AAGAGGAACCAGAGGCCCAGTGG + Intronic
1088553719 11:111039934-111039956 TAGTGGAAAGAGTGGCCCCCAGG - Intergenic
1088960676 11:114661809-114661831 CAGTGAAAAGATAGACACAGAGG + Intergenic
1089170801 11:116510261-116510283 CAGAGGAAGCAGAGACCCAGAGG + Intergenic
1089705331 11:120273652-120273674 CTGATGCAAGAGAGGCCCAGTGG + Intronic
1090496758 11:127220623-127220645 CAGAGGAAACTGAGGCACAGAGG - Intergenic
1091292651 11:134450501-134450523 CAGGGTACAGAGAGGCCCTGAGG - Intergenic
1091913058 12:4247304-4247326 CAGAGGAAAGTGAGGCCCGGAGG - Intergenic
1091948495 12:4571000-4571022 CAGGGGAAACAGAGGCCCTTTGG + Intronic
1092111690 12:5969148-5969170 AAGTGGAAAGAGAGGCTTAAAGG + Intronic
1092141822 12:6189260-6189282 CTGTGGAAAGCGAGCCTCAGAGG + Intergenic
1092147107 12:6222340-6222362 CAGAGAAAAGGGAGGGCCAGGGG - Intronic
1094504920 12:31053501-31053523 AAGAGGAAAGAGAGACTCAGAGG - Intergenic
1095491541 12:42739656-42739678 CTGTAAAAAGAGAGGACCAGAGG - Intergenic
1096259771 12:50083217-50083239 GGGAGGAAAGAGAGGCCTAGAGG + Exonic
1096657694 12:53102024-53102046 CACTGGAGAGAGAGGCACACAGG - Exonic
1097625688 12:61997465-61997487 CAGTGGAAAGAGAGGCCCAGTGG + Intronic
1098477459 12:70921248-70921270 GAGTGGAAAGAGAAGCAAAGAGG - Intergenic
1099424221 12:82502951-82502973 CAGTGAAATGACAGGCACAGAGG - Intergenic
1101489287 12:105196840-105196862 CTGAGGAAAGTGAGGCCCAGAGG + Intronic
1101578677 12:106021851-106021873 CAGTGAACAGAGAGGCAGAGAGG + Intergenic
1101714192 12:107296049-107296071 TAGTGTAACCAGAGGCCCAGAGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1102060008 12:109924982-109925004 CAGTGGAGAGCCAGGCCCAAGGG + Intronic
1104602939 12:130165157-130165179 CAGAGGAAAGACAGGACCCGGGG + Exonic
1106516298 13:30457274-30457296 CAGTGGAAAGCCAGGCACAGTGG - Exonic
1106852444 13:33808994-33809016 CAGTGGTTAGGTAGGCCCAGTGG + Intergenic
1107992948 13:45834437-45834459 CAGTGAAATTTGAGGCCCAGGGG - Intronic
1108340957 13:49497427-49497449 CGGAGGAAAGAGAGGCCCTGAGG - Intronic
1108760970 13:53563990-53564012 CATTGGGAAGTGAGGCTCAGTGG + Intergenic
1111858995 13:93677626-93677648 CAGTGGATAAAGAAGGCCAGAGG + Intronic
1111993416 13:95139025-95139047 CCGTGGAAGGAGAGGCCCAGGGG - Intronic
1112106770 13:96249047-96249069 GAGAGGAAAGAGAAGACCAGAGG - Intronic
1112212031 13:97387503-97387525 CAGGGGAAGGCGAGGCCCTGGGG - Intronic
1112390201 13:98976267-98976289 CAGTGGAAAAAGACCCCCAGAGG + Intronic
1112678850 13:101738599-101738621 CTGGGGAAAGAGAGACCCTGAGG + Intronic
1113036185 13:106052437-106052459 CCCTGGAAAGAAAGCCCCAGGGG + Intergenic
1113223877 13:108137983-108138005 CTGAGGAAAGAGAGGCTCAGAGG - Intergenic
1114267851 14:21083130-21083152 CTGTGGAAATAGAGGCCCAGAGG - Intronic
1115356519 14:32454199-32454221 CAGTGAAAAGAGAGATCCTGAGG - Intronic
1115939388 14:38591512-38591534 AAGTGGAAAGGGAGGAGCAGAGG - Intergenic
1115963732 14:38863972-38863994 CAATGGAAAGAAAGTCACAGAGG + Intergenic
1117325589 14:54666209-54666231 CAGTGGAAGGAGGGACCCAGAGG + Intronic
1118040565 14:61911553-61911575 CAGATGAAAAAGAGGCTCAGAGG + Intergenic
1118603805 14:67488601-67488623 TGGTGGAGAGAGAGTCCCAGAGG - Intronic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1119263917 14:73253336-73253358 CAGAGGAAAGAGCAGCCCTGTGG - Intronic
1119519078 14:75272276-75272298 GAGTGGGTACAGAGGCCCAGAGG + Intergenic
1119734837 14:76975165-76975187 AAGTGGAAAGTGAGGCCTCGGGG + Intergenic
1119765025 14:77182497-77182519 CTGGGGAAACTGAGGCCCAGGGG + Intronic
1119782310 14:77284677-77284699 CAGGGGAGAGAGGAGCCCAGAGG + Intronic
1120508273 14:85380221-85380243 GTGAGGAAACAGAGGCCCAGAGG - Intergenic
1120731093 14:88002364-88002386 TAGTGGGAAGTGGGGCCCAGTGG - Intergenic
1121955122 14:98206486-98206508 CAGTGGCAACAGAGGGCCAGAGG - Intergenic
1122235117 14:100327047-100327069 CAGAGGAAACTGAGGCCCTGAGG + Intronic
1122368486 14:101213565-101213587 CTATGGAAAAAGAGGCCAAGAGG - Intergenic
1124223600 15:27870384-27870406 CAAAGTAAAGATAGGCCCAGGGG - Intronic
1124695591 15:31861930-31861952 CAATGGCAAGAGATGGCCAGTGG + Intronic
1125518830 15:40337312-40337334 CAGAGAAAAGAGAGGACAAGGGG + Intronic
1126263919 15:46729745-46729767 CAGGGGAAAAAGAGAACCAGAGG - Intergenic
1126581933 15:50250063-50250085 CACTGGACAGAGAGCACCAGTGG - Intronic
1126870739 15:52984085-52984107 CAGTAGACAGAGAAACCCAGTGG - Intergenic
1127298113 15:57627593-57627615 AAGTGGACAGAGTGGGCCAGTGG - Intronic
1128214527 15:65925024-65925046 CAGTGGAATTGGAGGCCCTGTGG - Intronic
1128638270 15:69317192-69317214 GGGAGGAAAGTGAGGCCCAGAGG + Intronic
1128700517 15:69800971-69800993 GAGTGGAAAGAGAGAACCTGAGG - Intergenic
1128799961 15:70491011-70491033 AGGAGGAAAGTGAGGCCCAGAGG + Intergenic
1129760435 15:78126118-78126140 CAGGGGAAAGGGAAGCACAGAGG - Intronic
1130805288 15:87314306-87314328 CAGGGGAAGGAGAGGCTCAAAGG + Intergenic
1131183696 15:90257614-90257636 CTGTGGAAAGAGTGGCCCTGTGG - Intronic
1131698918 15:94910929-94910951 CAGTGGAAAGTGAGTCACAGAGG + Intergenic
1131941046 15:97565781-97565803 CTGTGCAAAGGGAGGCTCAGGGG - Intergenic
1132787658 16:1666909-1666931 CAGATGAAAGAGATGCTCAGTGG - Intronic
1136294080 16:29291879-29291901 AAATGGGAACAGAGGCCCAGAGG + Intergenic
1137277629 16:46946905-46946927 TAGTGGAAAGAAAAGACCAGTGG - Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138001391 16:53283572-53283594 CACTGGAAACAGAATCCCAGAGG - Intronic
1138308866 16:56006065-56006087 GAGTGAAGAGTGAGGCCCAGGGG + Intergenic
1138511380 16:57510413-57510435 CAGTGGAAAGTCAGCGCCAGTGG - Intergenic
1138526847 16:57613673-57613695 CCGTGGAAAGAGTGGGCCTGGGG - Intronic
1139357729 16:66377313-66377335 CTGAGGAAACTGAGGCCCAGAGG + Intronic
1140428475 16:74881308-74881330 CAGTGCAAAGAGAAGACCTGTGG + Intronic
1140745361 16:77975925-77975947 CAGTGGAAAGGGAGACCCTGAGG - Intronic
1141649274 16:85384579-85384601 GAAGGGAAAGTGAGGCCCAGGGG - Intergenic
1141945985 16:87310582-87310604 CAGGGGAGCGAGAGGCCCAGGGG + Intronic
1142562859 17:821338-821360 CAGAGGAAACTGAGGCTCAGAGG + Intronic
1142788487 17:2244366-2244388 CAGAGGAAAGAGAAACCCAGAGG + Intronic
1142812545 17:2401999-2402021 CAGAGGAAAGGGTGGCCCATGGG - Intergenic
1144050498 17:11493735-11493757 GAGTTGGAAGAGAAGCCCAGGGG - Intronic
1144134781 17:12283091-12283113 ATGTGGAAAGAGAGGCCATGAGG - Intergenic
1144283473 17:13749888-13749910 CAGTCTGTAGAGAGGCCCAGAGG - Intergenic
1145212386 17:21023812-21023834 CAGGGGAAACTGAGGCTCAGAGG - Intronic
1145817600 17:27806558-27806580 CTGAGGAAAGGGAGGCCCGGAGG - Intronic
1145845303 17:28033456-28033478 CAGGGGAGAGAGAGATCCAGAGG + Intergenic
1146436447 17:32853184-32853206 AAGTGGGAAGAGAGACACAGAGG - Intronic
1146714675 17:35075207-35075229 AGGAGGAAAGAAAGGCCCAGGGG + Intronic
1147155728 17:38543740-38543762 CAGGGGCAGGAGATGCCCAGTGG + Intronic
1147936332 17:44013334-44013356 AAGTAGAAACTGAGGCCCAGAGG + Intronic
1148556600 17:48582247-48582269 CGGAGGAGAGAAAGGCCCAGAGG + Intronic
1148677511 17:49453748-49453770 CACTGGCCAGAGAGGCCAAGAGG - Intronic
1148741925 17:49897898-49897920 CCGTGGAGAGAGAGGCCCTAGGG + Intergenic
1151208965 17:72529461-72529483 CTGGGGAAAGGGAGGCCCAGGGG + Intergenic
1151236536 17:72724184-72724206 GAGAGGAAAGAGAGGGACAGAGG + Intronic
1151759003 17:76090190-76090212 GAGTGGAGAGAGAGGCGCATAGG + Intronic
1153056941 18:955188-955210 CAGGGAAAAGGGAAGCCCAGTGG - Intergenic
1153432760 18:5036984-5037006 CTTTAGAAAGAAAGGCCCAGAGG - Intergenic
1153785012 18:8526510-8526532 CACTCGACAGAGAGGCCCACTGG + Intergenic
1153979695 18:10298173-10298195 AGGAGGAAAGAGAGGCCCTGAGG + Intergenic
1154077273 18:11215779-11215801 TAGTGGAAAGAGAGAAGCAGAGG + Intergenic
1155146876 18:23091551-23091573 CAGTGAAGAGAGAGAACCAGAGG - Intergenic
1155263918 18:24073181-24073203 CAATGGAGAGTGTGGCCCAGAGG - Intronic
1155433652 18:25788059-25788081 CAATGGAAAGGAAGGCCCAGAGG - Intergenic
1155881672 18:31156991-31157013 CAGTGGGAAGAGAGCCGCACAGG + Intronic
1158160153 18:54472595-54472617 CAGTGGAAATAGAAGCTTAGAGG - Intergenic
1158700700 18:59743302-59743324 CAGTGGAAAGTGGCTCCCAGAGG - Intergenic
1160919420 19:1512908-1512930 CGGGGGAAACTGAGGCCCAGAGG - Intronic
1161056428 19:2192932-2192954 CAGTGGGAAGAGAAGCACACAGG - Intronic
1161414358 19:4137094-4137116 AAGTGGAAACTGAGGCTCAGAGG - Intergenic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161482091 19:4516409-4516431 ATGTGGAAATAGAGGCTCAGAGG + Intronic
1161495576 19:4584234-4584256 CCGGGGAAACTGAGGCCCAGCGG - Intergenic
1161781074 19:6292365-6292387 CACTGGAAAGAGAGGAACAAAGG + Intergenic
1162068844 19:8141862-8141884 CAGGGGAGTGAGAGGCCCATCGG + Intronic
1162536884 19:11267941-11267963 CAGGGGACAGAGAGGCACTGAGG - Intergenic
1163458941 19:17424874-17424896 CAGAGTAAAGAGAGGGCCAAAGG - Intronic
1163505833 19:17705608-17705630 CAAAGGAAAGAGAGGCCCCACGG - Intergenic
1163765785 19:19162602-19162624 ATGGGGAAAGTGAGGCCCAGTGG + Intronic
1163921613 19:20295783-20295805 CCGTGGAAAGAGAGGCAGAGGGG - Intergenic
1164579415 19:29425334-29425356 GAGTGGGTAGAGGGGCCCAGTGG - Intergenic
1164690867 19:30210036-30210058 CAGTGGATGGAGAGTCTCAGGGG + Intergenic
1164740824 19:30574358-30574380 CTCTGCAAAGAAAGGCCCAGAGG + Intronic
1164998122 19:32738411-32738433 CAGAGGAAAGAGATGCCAGGAGG - Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1166225208 19:41390819-41390841 AAGTGGAAAGTGAAGCCCAGAGG - Intronic
1166668254 19:44694474-44694496 AAGTGGATAGAGAGGAGCAGGGG - Intergenic
1166731200 19:45059967-45059989 CAGCAGACAGAGTGGCCCAGGGG - Intronic
1166855891 19:45782476-45782498 AAGTGGCCAGAGAGGCCCAGGGG - Intronic
1167349057 19:48963631-48963653 CAGGGGAGAGAGAGGGGCAGAGG + Intergenic
1167525616 19:49981968-49981990 CAGTGGAATGTGGGGGCCAGCGG + Intronic
1167692955 19:50998184-50998206 GACTGGAAAGAGAGGGTCAGAGG - Intronic
1168404049 19:56101715-56101737 CTGTGGAAAGAGAACCACAGTGG + Intronic
1168412059 19:56146438-56146460 CAGGGGAAACCGAGGCACAGAGG + Intronic
1168467861 19:56618683-56618705 CAGTGGATGCAGAGGCCCTGAGG + Intronic
1168601484 19:57722329-57722351 CCACAGAAAGAGAGGCCCAGAGG - Exonic
925338144 2:3113891-3113913 CAGAGGAAAGAGACCCCCAGGGG + Intergenic
925620107 2:5783862-5783884 CTGTGGACAGAGAAGCCCACAGG - Intergenic
925775268 2:7329155-7329177 CAGTAGAAAAAGAGACACAGTGG - Intergenic
925804681 2:7636451-7636473 CAGTGAAAAGACAGGCAGAGTGG + Intergenic
926076247 2:9945496-9945518 CTGAGGAAAGTGAGGCTCAGAGG + Intergenic
926306198 2:11638983-11639005 TAGGGGAAAGAGAGCCCCCGGGG - Intronic
926439632 2:12874525-12874547 CAGTTGGAAGAGGGGCCAAGTGG + Intergenic
926685643 2:15695729-15695751 TACTGGAGAGAGAGGCCCATAGG + Intronic
926855998 2:17256771-17256793 CAGGGGAAAGTGAGGACCTGTGG + Intergenic
927093109 2:19727535-19727557 CAGTGGAATGAAAGACACAGGGG - Intergenic
928373841 2:30759490-30759512 CTGAGGAGACAGAGGCCCAGAGG + Intronic
928419107 2:31123827-31123849 AAGTGGAATGTGAGGCCAAGGGG - Intronic
928419196 2:31124344-31124366 AAGTGGAAAGTGAGGCTGAGGGG + Intronic
929271490 2:39977143-39977165 TGGTGGGAAGAGAGGCCAAGCGG + Intergenic
929938831 2:46315030-46315052 AAGTGGAAACTGAGGCACAGAGG - Intronic
929991798 2:46796552-46796574 CACTGGACAGAGAGCCCCTGGGG + Intergenic
930124167 2:47783344-47783366 CTGGGGAAGGAGAGGCCCCGGGG - Exonic
930581507 2:53217311-53217333 CAGGGGAAAGCGTGGCCTAGAGG + Intergenic
931644376 2:64408313-64408335 CATTGCAGAGGGAGGCCCAGTGG + Intergenic
932053314 2:68419939-68419961 CAGAGAAAAGAGAGCTCCAGAGG - Intergenic
932127511 2:69157254-69157276 CAGAGGAAAGAGAGCCCATGAGG - Intronic
932430648 2:71671996-71672018 GAGTGGAAGGAGAGGCTCACTGG + Intronic
932688557 2:73893538-73893560 CAGAGGACAGAGAGACCCACAGG - Intronic
932928772 2:76008571-76008593 AAGTGGAAAGAAAAGCCTAGAGG - Intergenic
933311517 2:80667128-80667150 CTCTGGAAAGAGAGACTCAGTGG + Intergenic
933553348 2:83802850-83802872 CGGTGTTAAGAGAGGCCTAGTGG - Intergenic
933721091 2:85398246-85398268 CAGTGGGCAGCGAGGCACAGTGG - Intronic
934779530 2:96960814-96960836 GAGTGGACAGAGAGGCCTACAGG + Intronic
934815577 2:97323468-97323490 CAGGGGAGGGAGAGGCCCTGGGG + Intergenic
934822118 2:97385015-97385037 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
935025064 2:99268956-99268978 GTGAGGAAATAGAGGCCCAGAGG - Intronic
935512657 2:103995262-103995284 CTGGGGAAACAGAGGCCCAGAGG - Intergenic
936025207 2:109026492-109026514 CAGAGGGAAGAGGGGCCCAAGGG - Intergenic
937490559 2:122362882-122362904 AAGGGGAGAGAGAGACCCAGAGG + Intergenic
937636107 2:124156890-124156912 CAGAGGAAACTGAGGCACAGAGG - Intronic
937961853 2:127466182-127466204 CAGTGCACAGAGAGGCCATGGGG - Intronic
938655314 2:133425498-133425520 CACTGGAAACAGATGCCCTGTGG + Intronic
939628054 2:144502624-144502646 GAGTGGAAAGAGAGGCAGAGGGG + Intronic
939640202 2:144631481-144631503 CAGGGTAAAGGGAGGCCCAAAGG - Intergenic
939893594 2:147766503-147766525 CATTGAAAAGAGAGGACAAGGGG + Intergenic
941295659 2:163736185-163736207 CAGTGGAGAGAGACGGGCAGCGG + Intergenic
942612009 2:177751925-177751947 CTGTGGAAAGGGAAGCCCAAAGG + Intronic
942646915 2:178122092-178122114 ACGAGGAAAGAGAGGCTCAGAGG - Intronic
942837241 2:180315126-180315148 AACTTGAAAGAGAGGACCAGGGG - Intergenic
943725613 2:191248269-191248291 CAGTGGAAACTGAGGCCTGGAGG + Intronic
945480396 2:210338276-210338298 CAGTGGAAGGTGAGTCACAGAGG + Intergenic
946443976 2:219722399-219722421 CAGAGGAGAGGGAGGCACAGTGG - Intergenic
947831898 2:233147329-233147351 CTGGGGCAAGAGAAGCCCAGTGG + Intronic
947907952 2:233779408-233779430 CAGAGGAAAGAGACGACCTGGGG + Exonic
947983007 2:234425999-234426021 CAGTGGGTAGAGTGGCCTAGAGG - Intergenic
948214629 2:236219618-236219640 CAGTGGAAGAAATGGCCCAGTGG + Intronic
948433453 2:237935749-237935771 AAGTGCACAGAGGGGCCCAGGGG - Intergenic
948726818 2:239939192-239939214 GAGTGGAAAGGGAGGCCTGGGGG + Intronic
948803597 2:240443633-240443655 CAGTGGGAGGTGAGGCCCAGCGG + Intronic
948888536 2:240896006-240896028 CAGTGGCAGGTGAGGGCCAGTGG + Exonic
949035028 2:241812310-241812332 AAGGGGAAACCGAGGCCCAGGGG - Intronic
1168771132 20:417687-417709 GAGTGGGAAGGGAGGGCCAGAGG - Intronic
1168874900 20:1164664-1164686 CTGGGGAAAGAGAGGCACTGAGG - Intronic
1169135479 20:3194703-3194725 GAGTGGACAGGGGGGCCCAGAGG - Intronic
1169219328 20:3812362-3812384 ATGAGGAAATAGAGGCCCAGTGG - Intergenic
1169718662 20:8648130-8648152 CAGAGGAAAGGGAAGCCCCGGGG - Intronic
1170029085 20:11925353-11925375 CAGGGGAAGAAGTGGCCCAGAGG - Exonic
1170212446 20:13858919-13858941 TAATGGAAAGAAAGGCCCAGAGG + Intronic
1170338878 20:15301141-15301163 CAGTGGAAGGAGTGACTCAGTGG - Intronic
1172015835 20:31872259-31872281 GAGTGGAAAGCCAGGCGCAGTGG + Intronic
1172124093 20:32614819-32614841 CAGTGGAAGATGAGGTCCAGAGG - Intergenic
1172590709 20:36115960-36115982 CAGGGGAAACTGAGGCTCAGAGG + Intronic
1172968898 20:38859144-38859166 CAGTTTAAAGACAGCCCCAGTGG - Intronic
1173341371 20:42155534-42155556 ATGTGGAAATGGAGGCCCAGAGG + Intronic
1173625233 20:44467511-44467533 CAGGGTAAAGAGATGCCCATGGG - Intergenic
1173855525 20:46248122-46248144 GAGGGGAAACTGAGGCCCAGAGG - Intronic
1173870339 20:46337842-46337864 CTGGGGAAGGAGAGCCCCAGAGG - Intergenic
1174363152 20:50040911-50040933 CTGGGCAAAGAGAGGCCCCGAGG + Intergenic
1174363438 20:50042528-50042550 ATGTGGAAACAGAGGCCCAGAGG + Intergenic
1174682410 20:52421337-52421359 AAGAGGAAACAGAGGCCTAGAGG - Intergenic
1175138276 20:56841282-56841304 CACTGGAAAGAGAAGTGCAGAGG - Intergenic
1175312237 20:58019914-58019936 AAGTGGAAACTGAGGCTCAGAGG - Intergenic
1175529284 20:59663041-59663063 CAGACGCTAGAGAGGCCCAGGGG - Intronic
1175540278 20:59743801-59743823 CAGGAAGAAGAGAGGCCCAGAGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175564793 20:59964868-59964890 AAGGGGAAACTGAGGCCCAGAGG + Intronic
1175756006 20:61530597-61530619 CAGTCGAAGGAGAGTCGCAGAGG + Intronic
1175858105 20:62133570-62133592 CAGGAAGAAGAGAGGCCCAGAGG + Intronic
1176072316 20:63233780-63233802 AAGTGGAAGGAAAGGCCCTGGGG - Intergenic
1177747939 21:25243754-25243776 CAGAAGAAATAGAGTCCCAGAGG - Intergenic
1178382714 21:32124260-32124282 CAGTGGAAGGTGAAGCACAGGGG - Intergenic
1178626449 21:34222746-34222768 CAGTGCAAAGACAGGGCCAAAGG + Intergenic
1179547315 21:42121599-42121621 GGGTGGAAAGAGTGGCCAAGAGG - Intronic
1180177898 21:46098897-46098919 CAGTGGAGACCCAGGCCCAGCGG - Intronic
1180976707 22:19852598-19852620 GAATGGAAGGAGGGGCCCAGGGG + Intronic
1181422689 22:22812546-22812568 GAGTGGAAAGACAGACACAGCGG + Intronic
1182506424 22:30786634-30786656 CAATTGAAAATGAGGCCCAGAGG + Intronic
1182547867 22:31086001-31086023 CAGAGGGTAAAGAGGCCCAGAGG - Intronic
1182667411 22:31970072-31970094 CAGAGTAAAGAGAGGCTCACAGG - Intergenic
1182825998 22:33265330-33265352 CAGTGGAATGAGGGGGTCAGTGG - Intronic
1183161020 22:36113211-36113233 GAATGGAGAGAGAGCCCCAGAGG + Intergenic
1183317537 22:37145192-37145214 CAGGGGAAACTGAGGCACAGAGG + Intronic
1183387914 22:37525573-37525595 CAGAGGAAAGGGCGGGCCAGGGG + Intergenic
1183395158 22:37567281-37567303 CAGTGCCAGGAGAGGCGCAGGGG + Intronic
1184332975 22:43837623-43837645 CAGTGGAAGCAGAGGCTCAAGGG + Intronic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
1184861832 22:47176749-47176771 CTGTGGAAAGAGAGGTGAAGAGG - Intergenic
950435949 3:12980189-12980211 CATAGGAAACAGAGGCACAGAGG + Intronic
950571487 3:13802996-13803018 CAGCGGTCAGAGAAGCCCAGAGG + Intergenic
950768902 3:15294897-15294919 CCTTGGAAAGAGAGGCTTAGGGG - Intronic
951241780 3:20294888-20294910 CAGTGGGAAGACAGGCCCCCAGG - Intergenic
952201290 3:31130815-31130837 CAGTGGAAAGCAGGGCCCTGTGG - Intergenic
952852001 3:37737241-37737263 CTGAGGAGAGACAGGCCCAGGGG + Intronic
953822672 3:46221948-46221970 CAGTGGCAAGAGAGGGGCTGGGG - Intronic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
955369590 3:58339744-58339766 CAGTGGAAAGAGCCACCCATGGG + Intronic
955520793 3:59773560-59773582 CATTGGAAATTGAGACCCAGAGG - Intronic
959600788 3:108182469-108182491 CTGTGACTAGAGAGGCCCAGGGG + Intronic
960084694 3:113578053-113578075 CAGTGGCAGGAGAGGGCCAAAGG + Intronic
961207765 3:125100122-125100144 CAAAGGAAAGAGAGTCTCAGAGG + Intronic
963400841 3:144796670-144796692 CACTGCAAACAGAGGCCCATTGG - Intergenic
965643461 3:170855777-170855799 AAGGGGAAACTGAGGCCCAGAGG + Intronic
965855271 3:173080531-173080553 GACGGGAAAGTGAGGCCCAGTGG + Intronic
966264557 3:178023481-178023503 CAGTGGAAAAGGAGACCCTGTGG - Intergenic
966695403 3:182785207-182785229 TGGTGGAGAGAGAGGTCCAGAGG + Intergenic
968565970 4:1313017-1313039 CCTTGGAAAGTGGGGCCCAGTGG + Intronic
968629804 4:1644501-1644523 CGGTGGAAACCGAGGCCCACGGG + Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969201247 4:5608109-5608131 AAGGGGAAAGAGAGGCCAGGAGG - Intronic
969327537 4:6452526-6452548 AAGAGGAAACTGAGGCCCAGAGG + Intronic
969502706 4:7563113-7563135 CAATGCAGAGAGAGGGCCAGGGG - Intronic
969714993 4:8864069-8864091 CAGAGCACTGAGAGGCCCAGAGG + Intronic
971965295 4:33547144-33547166 CAGTGCCAAAAGAGACCCAGAGG - Intergenic
972615490 4:40694238-40694260 CAGGGGAGACAGAGGCCCACTGG + Intergenic
976392588 4:84520744-84520766 GAGTTGAAAGAAAGGCTCAGAGG - Intergenic
976979241 4:91205711-91205733 CAGTAGAAAGGGAGGCCAGGTGG - Intronic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
982026327 4:151255999-151256021 CCGTGGAAAGAGAGGGGGAGAGG + Intronic
982130607 4:152225431-152225453 CAGGGGCATGAGAGGCTCAGAGG - Intergenic
982821305 4:159943411-159943433 CAGAGGAAGGAGAGTCCAAGAGG + Intergenic
982971047 4:161986976-161986998 CTGTGGAAGGAGAGGCCTATTGG + Intronic
984389589 4:179111658-179111680 CAGTGGAGAGAGAGGTGCTGTGG + Intergenic
985761707 5:1752303-1752325 CAGTGGAAACCGAGTCCCTGGGG - Intergenic
985911220 5:2884863-2884885 CAGAAGAAAGAGCTGCCCAGAGG + Intergenic
986827679 5:11539683-11539705 CAGTGCCATGAGAGCCCCAGTGG - Intronic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
988518991 5:31929560-31929582 CAGTGGAAGGCCAGGCGCAGTGG + Intronic
988519607 5:31933727-31933749 GTGTGGAAACAGAGGCCCACAGG - Intronic
989239663 5:39189449-39189471 CAGTGGGAAGAGATGGCCAGGGG - Intronic
989252498 5:39333622-39333644 CCGTGGAAAGAGAGGGAGAGGGG - Intronic
990381462 5:55224818-55224840 CAGAGGAAAGAGGCCCCCAGGGG - Intronic
991294639 5:65067383-65067405 CAGTGGAATGGGCAGCCCAGGGG + Intergenic
991462246 5:66871157-66871179 AGCTGGGAAGAGAGGCCCAGTGG + Intronic
992878139 5:81077870-81077892 CAGTGGAAACAAAGAGCCAGAGG - Intronic
992921400 5:81525539-81525561 CAGTGGAAATGGAAGTCCAGTGG - Intronic
993027422 5:82662810-82662832 CAGTGGAAGGAGGAGGCCAGGGG + Intergenic
994742751 5:103642082-103642104 CGGTGGAGAGAGAGGACAAGTGG - Intergenic
994788102 5:104188824-104188846 TAGTGGAGAGACAGGCCCACAGG - Intergenic
996805445 5:127449140-127449162 CCCTGGGAAGAGAGGCCCTGTGG + Exonic
997208524 5:132064437-132064459 CAGTGGAAGGAGGGGCAGAGGGG + Intergenic
997235016 5:132267685-132267707 CAGAGAAAAGAAAGGTCCAGGGG + Intronic
997244976 5:132340102-132340124 CAGTGGAAAGTTAGGTCCACAGG - Intronic
997375133 5:133392308-133392330 CTGTGAGAAGAGAGCCCCAGGGG + Intronic
997468333 5:134102834-134102856 CAGGGGAAACTGAGGCCCAGAGG - Intergenic
998570306 5:143251023-143251045 CAGTTGAGAGAGGGGCCCACCGG - Intergenic
998613072 5:143710555-143710577 CAGTGGAAGCAAAGACCCAGAGG + Intergenic
998946122 5:147341183-147341205 CAGGTGAAAAAGAGGCCCAGAGG - Intronic
999241705 5:150131794-150131816 CTGGGGAAACTGAGGCCCAGAGG + Intronic
999279878 5:150358037-150358059 ATGAGGAAAGTGAGGCCCAGGGG - Intronic
999425638 5:151485657-151485679 CTATGGAAAGAGAGGCCCAGAGG - Intronic
999616618 5:153431863-153431885 CAGAGGCAGGAGAGGCACAGAGG - Intergenic
1000992181 5:167922668-167922690 CAGTGGAAAGAGAGTGACTGAGG - Intronic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001520072 5:172385151-172385173 CAGAGGAAAAAGAGGCCCATGGG - Intronic
1001963629 5:175895206-175895228 CACTGGAACGGGAGGCACAGAGG - Intergenic
1002212265 5:177606010-177606032 CAGTGCAGAGGGAGGACCAGAGG - Intronic
1002313419 5:178328283-178328305 CTGGGGGAAGGGAGGCCCAGAGG - Intronic
1002431699 5:179207846-179207868 CAGAGGAAAGCGAGGTGCAGAGG + Intronic
1002640520 5:180628571-180628593 CAGGGCAGAGAGGGGCCCAGCGG + Intronic
1003137020 6:3441586-3441608 CAGTGGGCAGGGAAGCCCAGGGG - Intronic
1005332670 6:24764864-24764886 GAGGCGAAAGGGAGGCCCAGTGG - Intergenic
1005463903 6:26093281-26093303 CAGTGGGAAGAGGGGCAGAGGGG + Intronic
1005581968 6:27243773-27243795 CATTGAATAGAGAGGACCAGAGG - Intergenic
1005638828 6:27775596-27775618 TAGTGGAGTGAGAGGGCCAGGGG + Intergenic
1006104984 6:31711033-31711055 AAGTGGAAAGAGATGGACAGAGG + Intronic
1006191965 6:32215004-32215026 TGGTGGAAACAGAGGACCAGGGG - Intronic
1006994264 6:38243635-38243657 AAGGGGTAAGAGATGCCCAGGGG + Intronic
1007115153 6:39338182-39338204 CAGTGGACAGAGAGCCTGAGGGG + Intronic
1007677441 6:43608506-43608528 AAGTGGAAAGAAAGGCCCCAGGG - Intronic
1007714843 6:43849881-43849903 ATGAGGAAAGTGAGGCCCAGAGG + Intergenic
1008051383 6:46903344-46903366 CAGTGGACAGAGCTGTCCAGAGG + Intronic
1008561442 6:52728707-52728729 CATAGGAAAGAGACTCCCAGAGG + Intergenic
1014297979 6:119643759-119643781 TAGTGGAGAGAGAGGTCAAGAGG - Intergenic
1015589839 6:134812590-134812612 CAGTGGAAAGGCAGAACCAGAGG - Intergenic
1016310321 6:142727061-142727083 CAATGCAAGGAGAGGACCAGAGG + Intergenic
1016844106 6:148554136-148554158 CTGGGGACAGAGAGGGCCAGAGG + Intergenic
1017520293 6:155195896-155195918 CAGTGAGAGGTGAGGCCCAGAGG + Intronic
1018834502 6:167472916-167472938 CAGTTGTGAGAGAGACCCAGGGG - Intergenic
1018933858 6:168260645-168260667 CTGTGGAAGGAAATGCCCAGCGG - Intergenic
1019308780 7:348811-348833 CAGAGGGAAGAAAGGCCCAGGGG + Intergenic
1019330167 7:457384-457406 CATTGGGATGGGAGGCCCAGGGG - Intergenic
1019330222 7:457514-457536 CATTGGGATGGGAGGCCCAGGGG - Intergenic
1019388547 7:772579-772601 CCGGGGAACGAGGGGCCCAGCGG - Intronic
1020089913 7:5333179-5333201 GAGAGGAAACTGAGGCCCAGAGG + Intronic
1020127665 7:5541918-5541940 CAGTGCAGGGAGAGTCCCAGAGG + Intronic
1020536609 7:9405448-9405470 CAGAAGAATGAAAGGCCCAGAGG - Intergenic
1020911905 7:14141864-14141886 CGGTGGATAGAGAAGGCCAGTGG - Intergenic
1021609533 7:22444061-22444083 CTGTGGAGAGACAGGCCCACTGG - Intronic
1021715126 7:23454710-23454732 CAGTGGTAAGGGTGGGCCAGTGG - Intronic
1022342024 7:29477699-29477721 CAGTGGGAAGAAGGGCCAAGGGG + Intronic
1022489616 7:30806636-30806658 CAGGGGAAAGACATGCCCAAGGG - Intronic
1022930417 7:35106686-35106708 CTGTGGAAAGTGAGGATCAGAGG - Intergenic
1022973949 7:35540111-35540133 CATTGGGAAAAGAGGCCCATGGG - Intergenic
1023595613 7:41826705-41826727 AAGGGGAAAGAGAGTCCCTGAGG + Intergenic
1024186449 7:46952865-46952887 CAGTGGCAGGTGAGGCCTAGTGG - Intergenic
1024245008 7:47462814-47462836 CAGGGAGAAGAGAGGCACAGCGG - Intronic
1024248843 7:47491125-47491147 CAGTGGGCAGAGAGGCAGAGGGG + Intronic
1024489107 7:49957398-49957420 ATGTGAAAAGAGAGGCCTAGTGG + Intronic
1026220489 7:68392306-68392328 TGCTGGAAAGAGAGGCCCAGTGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027953166 7:84846079-84846101 CTGTGGAAAGAGATGACCACAGG + Intergenic
1028971753 7:96867192-96867214 CAGTGGTAAGGGAGGCTGAGGGG + Intergenic
1029113065 7:98223276-98223298 GGGTAGAAAGAGGGGCCCAGAGG + Intronic
1029126205 7:98296775-98296797 CAGTGGAGAGGGAGGCAGAGAGG - Intronic
1029521605 7:101066375-101066397 CAGAAGACAGAGAGCCCCAGGGG - Intergenic
1030884582 7:114922335-114922357 GAGGGGAAAGAGAGGCAGAGAGG + Exonic
1033172996 7:139100753-139100775 CCGTGGAAAGAGAGGGAGAGTGG - Intronic
1033451204 7:141463718-141463740 CAGTGCAAACAAAGGCCCTGAGG + Intronic
1034124681 7:148660751-148660773 GTGTGGCTAGAGAGGCCCAGGGG - Intergenic
1034462993 7:151208769-151208791 AAGAGGAAACTGAGGCCCAGAGG - Intronic
1035256205 7:157629556-157629578 CAGTGGAAAGTGAGTCCCCACGG + Intronic
1035791756 8:2312695-2312717 CAGTGGAAAGAGAGAGACAGGGG + Intergenic
1035801049 8:2409010-2409032 CAGTGGAAAGAGAGAGACAGGGG - Intergenic
1036103917 8:5819123-5819145 CAGTGAAAAGAGTGGCTCGGGGG + Intergenic
1036277433 8:7367761-7367783 CAGTGGAAAAAGAGACTGAGCGG - Intronic
1037219168 8:16496876-16496898 TAGTGGAACAGGAGGCCCAGAGG - Intronic
1037417650 8:18668172-18668194 GAGTGGGCAGAGAGGCCGAGGGG + Intronic
1037576036 8:20203863-20203885 CAATGGAAAGAAAGGCCAGGGGG - Intronic
1037765589 8:21770505-21770527 AAGGGGAAACTGAGGCCCAGAGG - Intronic
1038426365 8:27466707-27466729 GAGTCTAAAGAGAGCCCCAGGGG - Intronic
1039203541 8:35123616-35123638 CAGTGGAAAGAAAGGGACTGGGG - Intergenic
1039784744 8:40824112-40824134 CAGAGGAATCTGAGGCCCAGAGG + Intronic
1042958656 8:74279052-74279074 GAGTGGAAAGAGTGGCCTTGTGG - Intronic
1044201720 8:89446163-89446185 CAGTGGAAAATTAGACCCAGTGG - Intergenic
1045557529 8:103229024-103229046 CAGTGTACAGAGAGGCCAAGGGG - Exonic
1046340784 8:112851864-112851886 CAGTAGAAAGAAAGTCTCAGAGG + Intronic
1046688800 8:117258879-117258901 CAGTTGAAATAGAGACTCAGAGG - Intergenic
1047816808 8:128473705-128473727 CAGTGGTATGAGAGGCCCAGGGG - Intergenic
1048200946 8:132373553-132373575 CAGAGGAAACTGAGGCACAGAGG + Intronic
1048463509 8:134642344-134642366 CATTGGAAACGGAGGCTCAGGGG - Intronic
1048715690 8:137266095-137266117 CAGTAAAAAGAGAGGCCCGGAGG - Intergenic
1051538445 9:18187007-18187029 CAGTGGAAAGATAGCACTAGTGG + Intergenic
1052692796 9:31836498-31836520 CAGAGGTAAGTGAAGCCCAGGGG - Intergenic
1053350198 9:37409037-37409059 CACTGGAAGGTGAGGCCCAGGGG - Intergenic
1056679280 9:88703046-88703068 GAGTGGAATGAGCAGCCCAGGGG + Intergenic
1057146130 9:92760579-92760601 GTGGGGAAAGAGAGGCCCAGCGG + Intronic
1057883362 9:98809223-98809245 CAGTGGAAACAGTGGGGCAGAGG - Intronic
1057904827 9:98975384-98975406 AAGGGGAAACCGAGGCCCAGCGG + Intronic
1058836889 9:108865210-108865232 CAGCAGAAAGAGAGCCACAGAGG + Intergenic
1059427889 9:114232415-114232437 AAGTGGGAAGACAGGCCCTGGGG + Intronic
1061079577 9:128361889-128361911 TAGTGGAGATAAAGGCCCAGGGG - Intergenic
1061417184 9:130453438-130453460 TTGGGGAAAGTGAGGCCCAGGGG + Intronic
1061864127 9:133483798-133483820 CACTGCACAGAGAGGCCAAGGGG - Intergenic
1062070572 9:134553108-134553130 CAGTGGAAGGGGCGGGCCAGAGG + Intergenic
1187680880 X:21766992-21767014 CATTGAAGAGCGAGGCCCAGAGG + Intergenic
1190376888 X:49797081-49797103 CTGTGGAAAGAGACCCCCAAAGG - Intergenic
1190540370 X:51471297-51471319 CAGTGGAAAAAGAGCCTGAGAGG - Intergenic
1192151078 X:68712769-68712791 CAATGGCAAGAGAAGGCCAGAGG - Intronic
1192261711 X:69509484-69509506 GAGGGGAAATAGAGGCCCAAGGG + Intronic
1192585514 X:72315536-72315558 TAGGGGACAGTGAGGCCCAGTGG - Intergenic
1193132583 X:77932890-77932912 CCGTGGAAAGAGAGGGAGAGGGG + Intronic
1194628400 X:96252869-96252891 CATTGGAAAGTGAGGCCTTGAGG + Intergenic
1197278282 X:124505378-124505400 CAGTGGAAATAGACTCTCAGAGG + Intronic
1198310637 X:135424106-135424128 CAAGGGAGAGAGGGGCCCAGGGG + Intergenic
1198390156 X:136166366-136166388 CAGAAGAAAGAAAGGCCCAAAGG - Intronic
1199575205 X:149307037-149307059 GAGTGTCAACAGAGGCCCAGTGG + Intergenic
1199576852 X:149320602-149320624 ATGTGGAAAGAAAGGCCTAGAGG + Intergenic
1199969661 X:152850242-152850264 CTGTGGAAAGAGAGGAACGGTGG - Intronic
1200359784 X:155592568-155592590 CAGTGGGAAAAGAGAACCAGAGG + Intronic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic
1202095719 Y:21246637-21246659 CAGTGGAGAGAGGGGACCAATGG - Intergenic