ID: 1097631013

View in Genome Browser
Species Human (GRCh38)
Location 12:62062422-62062444
Sequence TCACAGCTGCAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097631013_1097631017 25 Left 1097631013 12:62062422-62062444 CCTTCCTCATGCTGCAGCTGTGA 0: 1
1: 0
2: 3
3: 28
4: 346
Right 1097631017 12:62062470-62062492 GTACAGACGCCAAGCCACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097631013 Original CRISPR TCACAGCTGCAGCATGAGGA AGG (reversed) Intronic
900499844 1:2998646-2998668 ACACAGCTGGAGCAGGAGGAGGG + Intergenic
900712804 1:4125152-4125174 ACCCAGCTGCACCGTGAGGAAGG + Intergenic
900996142 1:6124628-6124650 ACACAGGTGCCGCATGAAGAGGG + Exonic
901176477 1:7303054-7303076 TCCCAGCAGCACCAAGAGGAAGG - Intronic
901380883 1:8873288-8873310 TCACAGCAGAAGCAGGCGGAAGG - Intronic
901636079 1:10670808-10670830 TCACAGCTGAAGGATGGGGAAGG - Intronic
902055225 1:13595254-13595276 TCACAGCCACACCATCAGGAAGG - Intronic
902840367 1:19070395-19070417 TCCCAGCAGCACCAAGAGGATGG - Intergenic
903328835 1:22586617-22586639 TCACGGGTGCAGGCTGAGGACGG - Exonic
903482059 1:23660944-23660966 TCTGAGCTGCGGCATGTGGAAGG - Intergenic
903673679 1:25051411-25051433 CCACAGCTGGGGCATGAGGGTGG + Intergenic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
903931269 1:26863862-26863884 TCGCAGCAGCTGCATGATGAGGG - Exonic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904856262 1:33500246-33500268 ACTCAGCTGCAGCATGGGGTGGG - Intergenic
905209966 1:36367284-36367306 GCACAGCTACAGCCTGCGGACGG - Intronic
905878919 1:41450961-41450983 TCACCGCTGCAGCCAGAGGCAGG - Intergenic
905935760 1:41822823-41822845 TGACAGCTGCAGAATGCGGCAGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
907534645 1:55139182-55139204 TCACAGCTGTAGCATACAGATGG + Intronic
910824989 1:91397312-91397334 TCACAGTTGAAAGATGAGGAGGG - Intronic
911428392 1:97751655-97751677 TCACAGCTGTAGGCTGAGGTAGG + Intronic
911879284 1:103214097-103214119 TCACAGCTGGAGCATGACTGAGG - Intergenic
912233867 1:107827298-107827320 TCACACCTGGAGAATAAGGAAGG - Intronic
913022222 1:114799623-114799645 TCATGGCTGGAGCAGGAGGAAGG + Intergenic
913520972 1:119646058-119646080 TCACATCAGCAGCATGACTAAGG - Intronic
914756260 1:150563054-150563076 TCACAGCTGCAGCATGGGTCTGG + Intergenic
916825358 1:168437254-168437276 ACACTACTGCTGCATGAGGAAGG + Intergenic
920674637 1:208030549-208030571 TCAAAGCTGCAGACTGAGGAAGG + Intronic
924637237 1:245799805-245799827 CCAGCGCTGCAGCATGAGGTGGG - Intronic
924637254 1:245799911-245799933 CCAGTGCTGCAGCATGAGGTGGG - Intronic
1063146197 10:3297201-3297223 TCAGAGCAGCACCATGGGGACGG - Intergenic
1066199281 10:33129633-33129655 ACACAACCACAGCATGAGGATGG - Intergenic
1066472264 10:35710744-35710766 TCACAGCTACAGTGTAAGGAAGG - Intergenic
1066657983 10:37712672-37712694 CCACAGCTGCTGCATCAGGAGGG + Intergenic
1067042464 10:42962303-42962325 CCGCAGCTGCTGCATCAGGAGGG + Intergenic
1067448361 10:46366809-46366831 TCACAGCAGCAGCAGCTGGAAGG + Intergenic
1067589016 10:47493957-47493979 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1067636141 10:48002048-48002070 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1067748614 10:48955666-48955688 TCACAGCAGCTGCATCAGGAAGG - Intronic
1068683967 10:59849979-59850001 TCATAGCTGCAGCAGGGGAAGGG - Intronic
1069595383 10:69666681-69666703 TCACGGCTGGAGCCTGGGGAAGG + Intergenic
1070132702 10:73666053-73666075 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1070351743 10:75599236-75599258 TGACAGCTACAGCATTAGCAGGG + Intronic
1070937625 10:80313692-80313714 TGAGAGCTGCAGCAAGAGGTGGG + Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071549600 10:86556524-86556546 TGACAGCTGAATAATGAGGAGGG + Intergenic
1071812927 10:89203257-89203279 GAACAGCTGGAGAATGAGGATGG + Intergenic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072664399 10:97383413-97383435 TCACAGCAACCCCATGAGGAAGG - Intronic
1074189578 10:111124197-111124219 TCACAACAGCCTCATGAGGAAGG + Intergenic
1075672254 10:124270620-124270642 TCCCTGCTGCACCATGAGGCAGG + Intergenic
1077494546 11:2880560-2880582 TCTCAGCTGCTGGGTGAGGAAGG - Intergenic
1078630885 11:13003122-13003144 TCAGGGCTGCTGCATGAGCAAGG + Intergenic
1080447203 11:32348242-32348264 TACCAGCCACAGCATGAGGAAGG - Intergenic
1081407274 11:42712228-42712250 TCACCTCTGCATGATGAGGATGG - Intergenic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1083773677 11:64882568-64882590 CCACAGCTGCTGCAAGAGAAAGG - Intronic
1086555430 11:88104913-88104935 TCCCAGAAGCAGCATGAGAAGGG - Intergenic
1089413949 11:118271331-118271353 TCACAACCGCCCCATGAGGAAGG - Intergenic
1089702936 11:120256299-120256321 TCACAGCAGCACTATGAGGTAGG - Intronic
1090206679 11:124887989-124888011 TCACAGCTGCTGGATGAAGATGG - Intronic
1090500414 11:127255458-127255480 TCACAGCTGAAGCCTGATGACGG - Intergenic
1091205650 11:133819071-133819093 AGACAGGTGCAGCAAGAGGAGGG - Intergenic
1092886616 12:12929950-12929972 TCTCTGCTCCAGCATAAGGAGGG + Intergenic
1092946051 12:13455159-13455181 TCACAGCTACAGCATGCTGAAGG + Intergenic
1095830356 12:46579197-46579219 TCTCAGCTGAGGCAGGAGGAAGG - Intergenic
1097169641 12:57105552-57105574 TCCCAGCTACAGCAGGAGGTAGG - Exonic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1097779141 12:63683886-63683908 TTACAGCTGCAACAGAAGGATGG - Intergenic
1098187648 12:67914892-67914914 TTACAGCAGAAGGATGAGGAAGG + Intergenic
1099803863 12:87492653-87492675 ACACAGCTGAAGCAGGAGGGAGG - Intergenic
1100143527 12:91648788-91648810 TCACAGTAACAGCAGGAGGAGGG + Intergenic
1100212233 12:92409558-92409580 TTACAGGTAAAGCATGAGGAAGG - Intergenic
1100408450 12:94291338-94291360 TCCCAGCTGAGGCAGGAGGATGG - Intronic
1100714955 12:97295819-97295841 TCATGCCTACAGCATGAGGAAGG - Intergenic
1100797012 12:98192963-98192985 TCACAACTGAAGCATGTTGAGGG - Intergenic
1101863253 12:108499969-108499991 GCACAGCTGTAGCATGAAGTTGG + Intergenic
1102229947 12:111255688-111255710 TCACACCCGCAGCGTGATGAGGG + Intronic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104864018 12:131942093-131942115 ACACAGCTGCTGCAGGAGCAGGG + Intronic
1106454849 13:29918324-29918346 TCTCAGCTGTAGCCTGAGGCTGG - Intergenic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1109137126 13:58666458-58666480 TCGCAGATGGAGCATGAGAAAGG - Intergenic
1111962591 13:94827373-94827395 ACACAGCTCCAACATGTGGAAGG - Intergenic
1112951924 13:105008754-105008776 GCACAGCAGCAGCGTGAGGACGG - Intergenic
1113480655 13:110617949-110617971 TCAGTGCTGCAGCTTGCGGATGG + Intronic
1113559812 13:111269672-111269694 TCAGAGCTGCGGCGAGAGGAAGG + Intronic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1115755676 14:36524522-36524544 TCACAGACGCAGCGGGAGGAAGG + Intergenic
1116419009 14:44711749-44711771 TCTCATCTGTAGCATAAGGAAGG - Intergenic
1118508437 14:66443155-66443177 TCACAGCTGCAGCAGCAAAAGGG - Intergenic
1118894739 14:69936286-69936308 TCAGAGCTGCATCATAGGGAAGG + Intronic
1119715889 14:76859077-76859099 TGAGAACTGGAGCATGAGGATGG - Intronic
1122061513 14:99139446-99139468 ACACAGCTCCAGGGTGAGGATGG - Intergenic
1122283377 14:100637404-100637426 TCACAGCACCACCATGAGGTAGG - Intergenic
1122980641 14:105191020-105191042 TCACAGCTCCAGCAGGAGGGTGG - Intergenic
1123416268 15:20097771-20097793 TCCCATCTGAACCATGAGGAAGG - Intergenic
1123525607 15:21104876-21104898 TCCCATCTGAACCATGAGGAAGG - Intergenic
1123681265 15:22765822-22765844 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1123705551 15:22948268-22948290 ACACCCCTGCAGCTTGAGGATGG - Intronic
1124333476 15:28840284-28840306 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124532596 15:30520493-30520515 GCACAGCTGAAGGATGCGGAGGG - Intergenic
1124766057 15:32487151-32487173 GCACAGCTGAAGGATGCGGAGGG + Intergenic
1125687305 15:41571061-41571083 GCCCAGCTGAAGCAAGAGGATGG + Exonic
1128693411 15:69742658-69742680 ACACAGCTGGAGCAGGAGGCTGG + Intergenic
1128979179 15:72174462-72174484 CCACAGCTGGGGCATGGGGATGG - Intronic
1129530345 15:76260083-76260105 GCCCAGCTGAAGCAGGAGGATGG - Intronic
1132464207 16:70299-70321 TCCCACCTGCAGCCTGGGGAGGG - Intronic
1132577324 16:670050-670072 TCCCAGCTGGAGCATGAGCCTGG - Intronic
1132721077 16:1315894-1315916 TCGCATCTGCAGCCTGAGGCGGG - Intronic
1132953652 16:2579184-2579206 TCACAGCTGGAGCAGGGGTACGG + Intronic
1132960699 16:2620983-2621005 TCACAGCTGGAGCAGGGGTACGG - Intergenic
1133783627 16:8958370-8958392 GCACAGCTGCAGTCTTAGGATGG - Intronic
1134104065 16:11472729-11472751 TCACAGCTACGCCATGAGGCAGG - Intronic
1134305677 16:13029990-13030012 TCACAGCAGCATCATGAAGTAGG - Intronic
1134527902 16:14958366-14958388 ACATAGCTGGAGCAGGAGGAAGG - Intergenic
1135246178 16:20859138-20859160 TGACAGGTGCAGCATGTTGATGG + Exonic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1138138803 16:54548523-54548545 TCAGAGCTGCAGCGTGAGAGCGG + Intergenic
1139813693 16:69647335-69647357 GCAGAGCTGCAGTATGTGGATGG + Exonic
1140035620 16:71369238-71369260 TCATGGCAGCTGCATGAGGAGGG + Intronic
1141485768 16:84339361-84339383 TCCCAGGGGCAGCATGATGAAGG - Intergenic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1142003184 16:87675726-87675748 TCCCAGCTGCAGCAGGAAGCAGG + Intronic
1142096972 16:88245425-88245447 TCACAGCGGCTGCGGGAGGACGG - Intergenic
1142962333 17:3558629-3558651 TCACAGCTGCAGCCTGGGCCAGG - Intergenic
1143893412 17:10119106-10119128 TGACGGCTCCAGCATGAGGTGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1147560565 17:41506363-41506385 TCACAGCAGCCACAGGAGGAGGG + Intergenic
1148142355 17:45337909-45337931 CCACAGCAGCAGTGTGAGGAGGG + Intergenic
1148624989 17:49062446-49062468 TCCCAGCTAGAGCAGGAGGATGG + Intergenic
1149102463 17:52922662-52922684 TCACAGCTGGAGCCTCATGATGG - Intergenic
1149270260 17:54969207-54969229 CCACAGCTGGAGCAGGAGGGAGG + Intronic
1149455154 17:56781855-56781877 TGACAGCAACAGCATGAGAAGGG - Intergenic
1149467744 17:56893125-56893147 ACACAGATGCAGCAGGAGAAGGG + Intronic
1151108826 17:71651484-71651506 TTAGAGTTGCAGCATGAGGTGGG + Intergenic
1152536613 17:80953765-80953787 GCACAGCTGCAGCAGGAGCTGGG + Intronic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152727946 17:81956841-81956863 GCAAAGCTGCAGCACGAGGACGG + Intronic
1154049026 18:10935771-10935793 TCTCATCTGCAGCATGACCACGG + Intronic
1155170313 18:23262368-23262390 TCACAGATACAGCGTTAGGATGG + Intronic
1155980830 18:32177724-32177746 TGACAGCTGCTGCATGTGGTGGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156475297 18:37402158-37402180 TCACCGCCTCAGCATGAGAAGGG - Intronic
1157119057 18:44891181-44891203 TCACAACACCAGCATGAGAAAGG + Intronic
1157311388 18:46555890-46555912 TCACAGCTGCCACATGAGTTGGG - Intronic
1158378591 18:56902824-56902846 TTACTGCAGCAGCATAAGGAAGG + Intronic
1158935951 18:62364793-62364815 TCACAACAGCACCATGAGGTGGG + Intronic
1159061085 18:63514517-63514539 TCTCAGCTGCAGCAGGAGAGGGG - Intergenic
1160887276 19:1355673-1355695 TCACAGCAGCAGCAGAAGTAGGG - Intronic
1162341878 19:10096208-10096230 GCGCAGCTGCAGCACGAGGCGGG - Exonic
1164443718 19:28299759-28299781 GCAGAGCTGCACCATGAGTATGG - Intergenic
1165004710 19:32795420-32795442 TCACAGTAGCAGCATGAGATGGG + Intronic
1165363881 19:35352237-35352259 GCAGAGCAGCAGCGTGAGGAGGG - Exonic
1166361870 19:42255832-42255854 GGACAGCTGCAGCCTGGGGACGG - Intergenic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167423719 19:49418605-49418627 TCAGAGCTGCACCATGCAGATGG - Intergenic
925038973 2:715443-715465 TCACAGCAGCTGCATCTGGAAGG - Intergenic
925300797 2:2810709-2810731 TCACAGGTGCAGCAGGAGCAAGG - Intergenic
925423097 2:3727450-3727472 TTGCAGCTGCAGCATGTTGAAGG + Intronic
926903536 2:17784558-17784580 TCCCAGTTCCAGAATGAGGAAGG + Exonic
926991683 2:18687104-18687126 TCTCAGCTGCCTCATGAGGCAGG - Intergenic
928962233 2:36939462-36939484 TCACAGCAGTAACATGAGGTAGG + Intronic
929379350 2:41332199-41332221 CCACAGATGCAGTATGATGAGGG + Intergenic
931183403 2:59926454-59926476 TCACAGCTTCAAGAAGAGGAGGG - Intergenic
933480844 2:82855140-82855162 TAATAGCTGCTGCAGGAGGATGG + Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
935084760 2:99834350-99834372 TCACAGCTGCTTCATGAGGTAGG - Intronic
935418727 2:102844847-102844869 TCACAGCAACAGCATGAGGCAGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937903838 2:127042087-127042109 CCACAGCTGCTTCTTGAGGAGGG + Intergenic
937968899 2:127535091-127535113 TCCCAGCTGGAGGTTGAGGAAGG - Intergenic
938261872 2:129902539-129902561 TCAAAACTGCAGCATAAGTAAGG - Intergenic
938402540 2:131005258-131005280 ACACAGCAGCAGCCTGAAGAGGG + Intronic
938930964 2:136086677-136086699 TCAGAGCTGAAGCAGGAAGAGGG - Intergenic
939121426 2:138122304-138122326 TCAGAGATGAAGCATGAGTAGGG + Intergenic
940044017 2:149390351-149390373 TCACAGCTACAGCATGTAGGAGG - Intronic
942101273 2:172586430-172586452 TGGCAGCTACAGCATGTGGAAGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
946353234 2:219169080-219169102 ACAAAGGTGCAGCATGAGGGAGG + Exonic
946460317 2:219863092-219863114 TCACAACGGCAGAATGAGGGGGG + Intergenic
947134259 2:226961260-226961282 TCCCAGCTGCCCCACGAGGAGGG - Intronic
947433732 2:230054067-230054089 TCCCAGGTGCAGCCTGAGGTGGG + Intronic
947459506 2:230291077-230291099 TCACAGCTACATCATGAGGCAGG - Intronic
947469802 2:230390538-230390560 TCACAGCTACATCATGAGGTAGG - Intronic
947553187 2:231063040-231063062 CCACAGCTACCCCATGAGGAAGG + Intronic
948041425 2:234904694-234904716 TCACAGCTGCCTCATGAGCATGG + Intergenic
948699309 2:239750420-239750442 TCACACCTGCAGAACGAGCATGG + Intergenic
1168888825 20:1280526-1280548 TCACAACTGCTGTATGAGGTGGG + Intronic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1169781109 20:9311658-9311680 AAACAGCTCCAGGATGAGGAGGG - Intronic
1169798254 20:9488670-9488692 TCACAGCAGCACCATGAGGTAGG - Intergenic
1170850919 20:20003789-20003811 TAACAGCTGCCCAATGAGGACGG - Intergenic
1171010131 20:21505156-21505178 TCACATCAGCAGTCTGAGGAGGG + Intergenic
1171470940 20:25370723-25370745 TCACAGCTGCCTCATGAGATTGG - Intronic
1171473686 20:25391059-25391081 GCACAGCTGCAGCCTGCGGATGG - Intergenic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172274581 20:33672751-33672773 GCACAGTTCCAGCTTGAGGAAGG + Intronic
1172699272 20:36843021-36843043 TCCCAGTGGCAGCATGAGGAGGG - Intronic
1172782951 20:37447942-37447964 GCACAGCTGCAGGATGAGAGGGG - Intergenic
1173005445 20:39136633-39136655 TCACAGTTGCAGAATGACCAGGG - Intergenic
1173756886 20:45524677-45524699 CCACAGCTGAATCATGGGGAAGG - Intergenic
1174299375 20:49570368-49570390 TCAAAGCAGCCCCATGAGGAAGG - Intergenic
1174403900 20:50291593-50291615 TCCCACCTGCCGCATGAGGGAGG + Intergenic
1175261284 20:57675648-57675670 GCCCAGCGGCAGCTTGAGGAGGG + Intronic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1176235143 20:64050405-64050427 CCACCGCTGCAGCAAGAGGCAGG + Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179984762 21:44914136-44914158 CCAGAGCTGGAGGATGAGGAGGG - Intronic
1181886204 22:26024311-26024333 TCCCAGCTGCCCCAGGAGGAAGG + Intronic
1182276937 22:29195696-29195718 TCACAGCTGCCCCCAGAGGAGGG - Intergenic
1182908191 22:33956837-33956859 TCACAGCTGTAGCTTCAGAATGG - Intergenic
1183291252 22:37003243-37003265 TCAGAGCTGCTGCATCAGAAAGG + Intronic
1183814814 22:40290766-40290788 TCACTGCTGGAGCCTGAGCAGGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184281754 22:43441410-43441432 TCACAGAAGCTGCAGGAGGAAGG - Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
950096979 3:10336129-10336151 GCCCGGCTGCAGCAGGAGGAAGG + Intronic
952178571 3:30894086-30894108 TCAGAGCTGCAGATTGAGAACGG - Intronic
952388925 3:32863314-32863336 TCACAGCTGAGGCAGAAGGATGG - Intronic
954091494 3:48287906-48287928 TAACAGCTGGAGAGTGAGGAAGG + Intronic
956221075 3:66903923-66903945 TCACACCAGCCCCATGAGGAAGG + Intergenic
956931092 3:74043793-74043815 GCTCAGCTGCAGCATGATAAAGG + Intergenic
958111785 3:89157377-89157399 TAACAGCTGAAGTATGAGAAGGG - Intronic
958972088 3:100622864-100622886 TCCCAGCTGAGGCAGGAGGATGG - Intronic
961482601 3:127193569-127193591 TCGCAGCTGCAGCGGGTGGAGGG - Intronic
961636282 3:128335044-128335066 TCACAGCTGCAGGAACAGGGTGG - Intronic
964769829 3:160212573-160212595 TGTCAGCTGAAGCCTGAGGAAGG - Intergenic
965429710 3:168570850-168570872 TCACTGCAGCAGCATGGGCAAGG + Intergenic
966863342 3:184242568-184242590 CCAGAGCTGCAGCAGGATGACGG + Exonic
966863348 3:184242611-184242633 GCAGAGCTGCAGGATGTGGAAGG + Exonic
967891920 3:194369723-194369745 TCAAGGCTGCAGCATGAGTGTGG + Exonic
968286131 3:197509971-197509993 TCCCAGCTGCCCCAGGAGGAGGG - Exonic
968623351 4:1614580-1614602 TCACCGCAGCAGCAAGAGGACGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969353304 4:6610762-6610784 GCACAGCAGCAGCATGGGGCTGG - Intronic
969374192 4:6752432-6752454 TCTCAGCTGAGGCAGGAGGATGG + Intergenic
969666386 4:8559777-8559799 TCACAGCTGGATTATGACGATGG - Intronic
970151960 4:13099281-13099303 ACACGGCTGAAGCAGGAGGAAGG + Intergenic
970258994 4:14204058-14204080 TGACAGTTGCAGGCTGAGGAAGG - Intergenic
970941759 4:21642218-21642240 TCAAACCAGCAGCATCAGGATGG - Intronic
976379270 4:84380594-84380616 TCTCAGTTTCATCATGAGGATGG + Intergenic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
978638268 4:110837959-110837981 TCACAGCTGGAACAGGAAGAAGG - Intergenic
979408775 4:120347796-120347818 TCACAGTTGCAGCATGAAATAGG + Intergenic
979683460 4:123485796-123485818 TCCCAGCGGCAGCCTGAAGATGG + Intergenic
980833046 4:138155012-138155034 GCACAGGTTCAGCAAGAGGAAGG - Intergenic
981838144 4:149079403-149079425 ACACAGATGGAGCAAGAGGAAGG - Intergenic
981850039 4:149219030-149219052 GAAAAGCTGCAGTATGAGGAGGG - Intergenic
982161141 4:152570675-152570697 TGAGATCTGAAGCATGAGGAGGG + Intergenic
984814642 4:183825184-183825206 TCTCAGGTCCACCATGAGGACGG + Intergenic
985073265 4:186189825-186189847 TGACAGGTGCAGGATGAGGTGGG - Intergenic
985571424 5:647582-647604 ACACAGCTGCAGCCTGGGGAGGG + Intronic
985904411 5:2822593-2822615 CCACAGCTGCAGCAACAGAATGG - Intergenic
986182372 5:5405211-5405233 TCCCAGCTGATGCAAGAGGAAGG - Intergenic
986392254 5:7297816-7297838 GCACAGCTGAAGCATGAGGAAGG + Intergenic
986547912 5:8918824-8918846 TCACTGCTGCAATGTGAGGAGGG + Intergenic
986547919 5:8918858-8918880 TCACTGCTGGGGTATGAGGAGGG + Intergenic
986756201 5:10839025-10839047 TCACTGCTGGAGGATGGGGAAGG - Intergenic
988790959 5:34607101-34607123 TCATAGATTCAGCATGAAGAAGG - Intergenic
989788126 5:45356620-45356642 ACACAGCTATAGCATGAGAAAGG - Intronic
995262677 5:110123477-110123499 TCACAGCCGGGGCATGGGGAAGG + Intergenic
995481148 5:112594620-112594642 TCAGAGCTGCAGGATGAGAGAGG + Intergenic
996417125 5:123222573-123222595 TCTCAGCAGCAGCCTGAGAAGGG - Intergenic
997628618 5:135349108-135349130 TGCCTGCTGCAGCCTGAGGAAGG - Intronic
998828956 5:146137011-146137033 TCCCAGCTGCAGGCTGAGGCAGG - Intronic
999654434 5:153798412-153798434 TTACAGATTCAGCATGTGGAGGG + Intronic
1000154614 5:158538532-158538554 TGACAGCCGCAGCAGTAGGAGGG - Intergenic
1001204064 5:169745674-169745696 TCACAACCACAGCATGAGGCAGG - Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002390473 5:178907919-178907941 TGACAGGTGCAGCATGTTGATGG + Intronic
1003436348 6:6092033-6092055 TCACTGCTGGTGCATGAGGTAGG - Intergenic
1004473621 6:15950866-15950888 TCACAACAGCACCATGAGGTGGG + Intergenic
1006703630 6:35997655-35997677 TCACAGGAGCAGTATAAGGAAGG + Intronic
1007115770 6:39342200-39342222 TGACAGCTGCATCATGAGAATGG - Intronic
1007290146 6:40779561-40779583 TCACAGCCACAGGATGAGGGGGG + Intergenic
1008616404 6:53230666-53230688 TCATAGCTGCAGCAGGAGGTGGG + Intergenic
1010275566 6:73965015-73965037 TCAGAGATGCAGTATTAGGAAGG + Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012637593 6:101564271-101564293 GCACAGCTGTGGCATGGGGATGG + Intronic
1012901460 6:105011731-105011753 TCCCAGCTGCAGGCTGAGGCAGG + Intronic
1013043999 6:106465458-106465480 TCAGGGCTGCAACAGGAGGAAGG + Intergenic
1013181147 6:107718040-107718062 TCAGAGCTGGAGGCTGAGGAAGG + Intronic
1013508676 6:110824866-110824888 TCATAGCTGCCCTATGAGGAAGG + Intronic
1014215106 6:118745615-118745637 TCACAGCTCCAGTAAGAGCAGGG + Intergenic
1014254767 6:119149939-119149961 TCACACCAGCATCATGAGGCAGG - Intergenic
1014735881 6:125095800-125095822 TCACAGCTGCATCATTAAAAGGG - Intergenic
1016453081 6:144203548-144203570 TCACTGCTACAGCATGAGGTGGG - Intergenic
1019079903 6:169423387-169423409 GCACAGCTGCAGTTAGAGGAAGG + Intergenic
1019350784 7:553002-553024 GCACAGATGCAGCCTGCGGACGG + Intronic
1021902703 7:25303172-25303194 TCACAACAGAAGCATGTGGAAGG - Intergenic
1022938066 7:35201531-35201553 TTACAGCTGCAACAGAAGGATGG - Intergenic
1024097523 7:45995091-45995113 TCACTGCTGCTGCCTGGGGAAGG + Intergenic
1024575639 7:50761818-50761840 TCACAACAGCACCACGAGGATGG - Intronic
1027219277 7:76203675-76203697 TCACAGAAGCTTCATGAGGAAGG + Intronic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1031666033 7:124482908-124482930 TCACACCTACCACATGAGGAAGG - Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032854590 7:135823914-135823936 CCACAGCAGCAGCATCAGTAGGG - Intergenic
1033569540 7:142614452-142614474 TCAATGCTGCAGGATGAGAAAGG + Intergenic
1033597151 7:142866273-142866295 TGATGGCTGCAGCCTGAGGAGGG - Exonic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034398411 7:150845632-150845654 ACACAGCTGCAGCTGGAGGGAGG + Intronic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035557520 8:577987-578009 TCACCCCTGCTGCATGAGGTGGG - Intergenic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1036807863 8:11847601-11847623 TCTTCGCTGCAGCGTGAGGAGGG + Intronic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037683732 8:21119876-21119898 TCCCAGCTGGAGGCTGAGGAGGG + Intergenic
1039306669 8:36270592-36270614 CCACCGCTCTAGCATGAGGATGG - Intergenic
1040492118 8:47933648-47933670 TAACAGGTCCAGCCTGAGGATGG - Intronic
1041733615 8:61087468-61087490 TCTGAGTTGGAGCATGAGGAGGG - Intronic
1042767308 8:72337621-72337643 TCCCCGCAGCTGCATGAGGAGGG - Intergenic
1044577123 8:93782021-93782043 TCCCAGCTGAAGCAGGAGAATGG - Intronic
1045434005 8:102141282-102141304 TCACAACTTCAGTATGTGGAGGG + Intergenic
1046809195 8:118514483-118514505 TCACTGCCACAGGATGAGGAAGG + Intronic
1047272321 8:123373865-123373887 TAACAGATGCAGCCTAAGGATGG - Intronic
1047466005 8:125115049-125115071 TGAGAGTTGGAGCATGAGGATGG - Intronic
1047782583 8:128122337-128122359 TCACAGCAGTAGCAGGAGGCAGG - Intergenic
1048268032 8:133004812-133004834 TCCCAGCACCAGCATGAGAATGG + Intronic
1048274709 8:133057531-133057553 TCACAGCGACAGCATGATGCAGG - Intronic
1049158791 8:141084363-141084385 TCTCAGCTGAAGCTTCAGGAGGG - Intergenic
1049179809 8:141216412-141216434 TCTGAGCTGCCGCATCAGGAAGG - Intronic
1049282484 8:141757146-141757168 TCTCAGCAGCACCATGGGGAGGG + Intergenic
1049360314 8:142209649-142209671 CCACAGCTCCCACATGAGGAGGG + Intergenic
1049407566 8:142458427-142458449 TCACAGCTTCTGCATGAGGTGGG - Intronic
1049699997 8:144006314-144006336 TCACAACGACAGCAGGAGGAGGG + Intronic
1050292081 9:4165588-4165610 TCACTGCAGCAGAATCAGGAAGG + Intronic
1050694466 9:8263204-8263226 TCACAGCTGAACCAGGAAGAGGG + Intergenic
1051106743 9:13588810-13588832 ACACATCTTCAGCATGATGAAGG + Intergenic
1052799280 9:32952664-32952686 ACACAGCTGGAGCAGGAGCAGGG + Intergenic
1052956546 9:34256864-34256886 TCACAGCTGCAGCCCAAGTAAGG - Exonic
1052959402 9:34281930-34281952 TCCCACCAGCAGTATGAGGATGG - Intronic
1053019652 9:34686009-34686031 TCTCAGCTGCAACATAAGAATGG + Intergenic
1056821989 9:89848948-89848970 AGAAAGCTGCAGCAGGAGGAAGG - Intergenic
1059463854 9:114452951-114452973 TCCCAGCAGAAGCATCAGGATGG - Intronic
1059487196 9:114635869-114635891 TAACAGTTGCAGCGGGAGGATGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1061051892 9:128201686-128201708 TCACAGCTGCAGCTTAATAAGGG + Intronic
1061748558 9:132757907-132757929 CCACAGCTTGAGCACGAGGAGGG + Intronic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1062379117 9:136278289-136278311 TCCCAGCTGTGGCCTGAGGAGGG + Intergenic
1062583456 9:137238227-137238249 CGACAGCTGCAGGAGGAGGAGGG + Intergenic
1062708258 9:137957155-137957177 GCATAGCTGCAGCAGCAGGAAGG + Intronic
1062731432 9:138112381-138112403 TCCCAGCTGCACCAGGATGATGG - Exonic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188655871 X:32694514-32694536 TCACATCTACTGCATCAGGAGGG + Intronic
1190084312 X:47382215-47382237 TCACAGGTGCAGGATGACAAAGG - Intronic
1190154426 X:47976653-47976675 TCTCTGATGCAGCATGAGGTAGG + Exonic
1190470554 X:50775092-50775114 CCAAAGCAGCAGCATCAGGAGGG - Intronic
1191852158 X:65593356-65593378 TCACAGCTTCAGCAACAGCAAGG - Intronic
1192026621 X:67459407-67459429 ACACAGCTGAAGCATTAAGAGGG + Intergenic
1192171263 X:68856541-68856563 TCACAACAGCCACATGAGGAAGG + Intergenic
1192215070 X:69152468-69152490 TCACAGCAGCTGTATAAGGAAGG - Intergenic
1192502364 X:71662461-71662483 TAACAGCTCCAGAAAGAGGACGG + Intergenic
1192926533 X:75759969-75759991 GGAAAGCTGCAGTATGAGGATGG - Intergenic
1193588012 X:83351276-83351298 ACATAACTGCAGCCTGAGGAAGG - Intergenic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1197414940 X:126164453-126164475 GCACAAATGCAGCATGAAGAAGG + Intergenic
1198011017 X:132554303-132554325 TCACCTCTGCAACATGAGGCTGG - Intergenic
1198430950 X:136565571-136565593 ACACAGCTGCTCCATGGGGATGG + Intergenic
1199011029 X:142759140-142759162 TCATGGCTGGAGCAGGAGGAAGG - Intergenic
1199238434 X:145517707-145517729 TCACGGCTGCAGTATCAGGGAGG + Intergenic
1199484957 X:148337676-148337698 CCACTGCTGCAGGATGGGGAAGG - Intergenic
1199712178 X:150477228-150477250 TCACAGCAGCCCCATGAGAAAGG - Intronic
1200076670 X:153554663-153554685 GCACGGCTGCAGCCAGAGGAGGG + Intronic
1200141827 X:153906363-153906385 CCACAGCTGCACCAGGAAGAAGG - Exonic