ID: 1097631964

View in Genome Browser
Species Human (GRCh38)
Location 12:62074987-62075009
Sequence TTCAAGATCTTCAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097631964_1097631966 25 Left 1097631964 12:62074987-62075009 CCACCACACTTGAAGATCTTGAA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1097631966 12:62075035-62075057 AACTCATCACAAATGAAATATGG 0: 1
1: 0
2: 2
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097631964 Original CRISPR TTCAAGATCTTCAAGTGTGG TGG (reversed) Intronic
902335265 1:15750942-15750964 TTTAAACTCTTCAAGTTTGGGGG - Intergenic
902394775 1:16126633-16126655 TTTGAGACCTTCAAGTGTGTGGG - Intronic
902919424 1:19657316-19657338 TTTAATATATTCAAGAGTGGGGG + Exonic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906642234 1:47448406-47448428 TTTCGGATCTTCCAGTGTGGTGG + Intergenic
907846433 1:58212603-58212625 TCAAAGAGCTTCAAGAGTGGGGG - Intronic
908236330 1:62150726-62150748 TTCAAAATAGTTAAGTGTGGTGG + Intronic
909630098 1:77761766-77761788 TTCAAGATCACCAGGTGCGGTGG + Intergenic
912053044 1:105555414-105555436 TTAAAGATCTTTCAGTCTGGTGG + Intergenic
915196341 1:154192745-154192767 TCCCAGAGCTTCAAGTGGGGTGG + Intronic
915796021 1:158734144-158734166 TTTAATCTCTTCAAGTGTGTGGG - Intergenic
915956881 1:160228041-160228063 TTAAATATCTCCAGGTGTGGTGG - Intronic
917032098 1:170704643-170704665 TCCAAGATCATCATTTGTGGAGG - Intronic
919399456 1:197093313-197093335 TTCAAGAACTTCTAGTGGGTTGG - Intronic
1065098971 10:22315324-22315346 TGCAAGTTCTTGAAGGGTGGAGG - Intergenic
1068807177 10:61210436-61210458 TTTAGGACCCTCAAGTGTGGGGG - Intergenic
1073404067 10:103281528-103281550 TACAGGATTTTCGAGTGTGGTGG + Intronic
1074346344 10:112689853-112689875 TTCTATATCTTGATGTGTGGTGG - Intronic
1076378069 10:130004915-130004937 TTCCAGATATGCAAGTTTGGGGG + Intergenic
1076546720 10:131250355-131250377 TTGCAGATGTTCAAGTGAGGTGG + Intronic
1079778415 11:24564101-24564123 TGCAAGATTTTAAAGTGTGTGGG + Intronic
1080836200 11:35943546-35943568 AACAAGATCGTCAAGTGTGCCGG + Intergenic
1081418112 11:42840070-42840092 TTCAAGGTCTTTAGGGGTGGTGG - Intergenic
1086963797 11:93007365-93007387 TTCATCATCAACAAGTGTGGAGG - Intergenic
1087666825 11:101059032-101059054 CTCAACCTTTTCAAGTGTGGGGG - Intronic
1088007161 11:104955657-104955679 TTCCTAATCTTCCAGTGTGGTGG + Intronic
1097631964 12:62074987-62075009 TTCAAGATCTTCAAGTGTGGTGG - Intronic
1097937679 12:65271812-65271834 TTCAAGATTTTCAAGAGAGCTGG + Intergenic
1099578375 12:84408026-84408048 TCCAAGTTCTTCAAGTTTTGGGG + Intergenic
1101536145 12:105618479-105618501 ATCAAGACTTTCAAGTGTGCAGG - Intergenic
1102339068 12:112107917-112107939 ATCAAGGTCTTCAAGTCTGCGGG + Intronic
1106229309 13:27809555-27809577 CTTGAGATCTTCAGGTGTGGAGG + Intergenic
1107146119 13:37062093-37062115 TTCCAGACCTACAAGGGTGGTGG + Intergenic
1109147447 13:58798003-58798025 TTAATGATCTTGAAATGTGGAGG + Intergenic
1109306557 13:60647984-60648006 TTCAACATCTTAAAGTGTAGTGG + Intergenic
1113222497 13:108120880-108120902 TTCAGGATTTACAAGTGCGGCGG + Intergenic
1114440449 14:22742460-22742482 CTCAAGATATTCCAGTGTGATGG - Intergenic
1116424024 14:44767606-44767628 ATCAATATCTTCAAGTTTTGTGG + Intergenic
1118069949 14:62235388-62235410 TTCAACATCTTCCGGTGGGGCGG - Intergenic
1120534931 14:85683053-85683075 TAAAAGATGTGCAAGTGTGGAGG + Intergenic
1121478845 14:94243116-94243138 TTGATGATCTGCAAGTGTGCAGG + Intronic
1127796794 15:62445270-62445292 TTCAAGACCTCCAAAGGTGGAGG - Intronic
1130235693 15:82131529-82131551 TTTAAAATGTTCAAGTTTGGGGG + Intronic
1131390561 15:92044528-92044550 TCCTAGATCTTCAACTCTGGAGG + Intronic
1135883630 16:26283527-26283549 TTCAAAATCCCCAATTGTGGTGG - Intergenic
1139038492 16:62976424-62976446 TTCAGGATCTTCATGTCTGGAGG + Intergenic
1140813001 16:78596353-78596375 TTCAAGAGCATGTAGTGTGGTGG + Intronic
1143939382 17:10524062-10524084 TTCAGCATCTTCAAGTGTATAGG + Intronic
1149812191 17:59687036-59687058 TTTAACATCTTTAAGTCTGGAGG + Intronic
1150524592 17:65908739-65908761 TTCAAGTTCTGCATGTGTTGTGG - Intronic
1158618107 18:59006152-59006174 TTAAGGATCTTAAAATGTGGGGG + Intergenic
1159089067 18:63826156-63826178 TTCAAGTTCTTCCAATGAGGAGG + Intergenic
1162025066 19:7889016-7889038 TCCCAGATCTTCAAGTCTGCTGG + Intronic
927373384 2:22383850-22383872 TTCATGATGTTCAAGTGTTTTGG + Intergenic
928460754 2:31470228-31470250 TCCATGATCTGCAAGAGTGGGGG - Intergenic
930132342 2:47865240-47865262 TTCAAGATGTTCATCTGTGCAGG - Intronic
932130528 2:69183307-69183329 TTTAAGATCTGGAGGTGTGGGGG - Intronic
933263549 2:80156272-80156294 TTGAACATCTTCAAGTATGTTGG - Intronic
934879973 2:97968116-97968138 TGCAAGAGCTTTCAGTGTGGTGG - Intronic
938646910 2:133341303-133341325 GTCATGATCTTCAGGTGTGTGGG - Intronic
946227295 2:218270713-218270735 TGCAAGATCTTAGAGTCTGGGGG + Intronic
948094466 2:235322416-235322438 TTCAAAATAGTCAAGTGGGGTGG - Intergenic
1169837628 20:9898149-9898171 TTCAGGAGCTTTAAGTGTGAAGG + Intergenic
1179398467 21:41062357-41062379 TATAAGATCTTCAGGGGTGGGGG + Intergenic
1181431897 22:22886875-22886897 TTCCTCATCTTCAAATGTGGAGG + Intronic
1183827504 22:40399972-40399994 TTAAAGACATACAAGTGTGGGGG - Intronic
950397944 3:12748570-12748592 TTCAATGACTTCAAGTATGGGGG + Intronic
953366790 3:42352121-42352143 TTAAGGATCTTGAAGTGGGGAGG - Intergenic
957567649 3:81905484-81905506 TTTAAGATAATCAAGAGTGGAGG - Intergenic
959120260 3:102223950-102223972 TGCAAGATGGTTAAGTGTGGAGG + Intronic
961095260 3:124149389-124149411 TTCAAGATCATGCATTGTGGAGG - Intronic
964197169 3:154078478-154078500 TTGAAAATCTTCAAGATTGGGGG - Intergenic
967506846 3:190262063-190262085 TTCCAGATCTACAATGGTGGTGG + Intergenic
967681598 3:192370148-192370170 TTAAAGATCCTCAAGTGTCCTGG - Intronic
967881963 3:194307855-194307877 TCCGAGATCTGCAAGTGGGGGGG - Intergenic
970483854 4:16504885-16504907 TCCAAGCCCTTCAAGTGTGCTGG - Intronic
973100256 4:46258819-46258841 TTTCAGATCTTAAAGTATGGAGG + Intronic
973603143 4:52561495-52561517 CTCAATATCAGCAAGTGTGGTGG - Intergenic
975182750 4:71365713-71365735 TTCAACATCTTGAAGAGTGTTGG - Intronic
976600415 4:86933288-86933310 TTCATGACATTCCAGTGTGGTGG - Intronic
977573311 4:98652231-98652253 TATAAGGGCTTCAAGTGTGGGGG - Intronic
977621085 4:99137784-99137806 TTCAAAATATTCCAATGTGGGGG - Intronic
980055523 4:128075697-128075719 TTAAAAATCTCCCAGTGTGGTGG - Intronic
981880480 4:149605338-149605360 TAAAAGATTTTCAAATGTGGAGG - Intergenic
982177474 4:152719448-152719470 TTCTAAATCTTCATGTGTGGAGG + Intronic
982664372 4:158243584-158243606 TTTAAGCTATTCAAGTTTGGTGG - Intronic
982982711 4:162161277-162161299 TGAAAGATATTCAAATGTGGTGG - Intronic
983282557 4:165699397-165699419 TTGAAAATCCTCAACTGTGGTGG - Intergenic
984966618 4:185145136-185145158 ATCAAGATCTTCAAGTCTGATGG + Exonic
986313925 5:6573516-6573538 ATCAAGATCTTCAAGAGAGAAGG - Intergenic
986379148 5:7165655-7165677 ATCCAGATCTTCAAGTGAGGCGG - Intergenic
989026749 5:37076597-37076619 TTCAACATCGCCAGGTGTGGTGG - Intergenic
989045737 5:37271704-37271726 TCCAAGTTCTTCATTTGTGGGGG - Intergenic
990849858 5:60190760-60190782 TTCAAGATGTTAAACTGTGCTGG - Intronic
992742604 5:79789350-79789372 ATCAGGATCTTCAGGAGTGGAGG - Intronic
993069475 5:83141670-83141692 TTCAACATCTTCAAATTTGAAGG - Intronic
993099695 5:83522085-83522107 TACAATATCTTCAAGGGTAGTGG - Exonic
994178963 5:96743263-96743285 GTTAAGATCTTGGAGTGTGGCGG - Intronic
998747628 5:145278868-145278890 TTGAAGATCTTCTAGAGTTGAGG + Intergenic
1000481328 5:161778893-161778915 TTCAAGATGTTCATTTGTTGGGG + Intergenic
1003834984 6:10061192-10061214 TTTAAGAACTTCAGGTTTGGGGG - Intronic
1003988128 6:11458175-11458197 TTCATGAAGTTCAAGTGTGAAGG + Intergenic
1007282778 6:40724685-40724707 TTCCAGAAATTCAAGTGTGAGGG + Intergenic
1010437834 6:75855873-75855895 TGCAGGATCTTCATTTGTGGAGG + Intronic
1012488304 6:99747392-99747414 ATTAAGATCTTCAGGTGTGGTGG + Intergenic
1013796877 6:113898018-113898040 TTCAAGATCTAGAAGTCTGTTGG - Intergenic
1015815028 6:137200633-137200655 TTAAAGATCTTAAAGTCTAGGGG - Intronic
1016298275 6:142599829-142599851 TTAAAAATTATCAAGTGTGGTGG + Intergenic
1018834295 6:167471545-167471567 GCCAAGATGTTCAAGTCTGGAGG - Intergenic
1020994703 7:15248816-15248838 TTAAAGAGCTTAAAGTGAGGAGG + Intronic
1021700595 7:23315741-23315763 TTCAAGAGCTTCAGTTTTGGAGG - Intronic
1021919909 7:25474486-25474508 TTCAAAATCTTCATGTTTTGAGG - Intergenic
1022293906 7:29031587-29031609 TTCAACATTTTTAAGTTTGGGGG - Intronic
1022411776 7:30144245-30144267 TTCAAGTTTTTGAAATGTGGTGG + Intronic
1024118994 7:46218590-46218612 TTCAAGATTTCCATGTGTGTGGG + Intergenic
1026150200 7:67781728-67781750 TGCAAGATCTTCATTTGTGGAGG + Intergenic
1029646847 7:101862312-101862334 TCCAAGAGCTTCCAGTCTGGTGG + Intronic
1033017864 7:137690336-137690358 TTAAAGTTGTTCAAGTATGGTGG - Intronic
1033147145 7:138881155-138881177 TTCATGATCTTCAACCGTGTGGG + Intronic
1041402077 8:57456739-57456761 CTCAGGATCTCCAAGTCTGGGGG + Intergenic
1041752921 8:61280913-61280935 TTAATGATCTCCAAGCGTGGTGG - Intronic
1046242661 8:111517120-111517142 TTGAAAATCTTCCAGTTTGGTGG + Intergenic
1046483859 8:114859253-114859275 ATCAACATGTTCAAGTCTGGAGG + Intergenic
1047172818 8:122510643-122510665 TCCAAGAGATTCAAGTTTGGAGG + Intergenic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1048468180 8:134684830-134684852 TTCCAGAACTGCAAATGTGGGGG + Intronic
1048662819 8:136625571-136625593 TTTAAGAACTTGAATTGTGGAGG + Intergenic
1050052210 9:1614950-1614972 TTAAAGGACTTCAAGTGTGCAGG - Intergenic
1050268945 9:3921005-3921027 TGCAAGATCTTTAAGTTTGGTGG - Intronic
1055392963 9:75843252-75843274 TTCAACATCTAAATGTGTGGGGG - Intergenic
1058586419 9:106511457-106511479 TTTAAGAAATTCAAGGGTGGGGG - Intergenic
1059130448 9:111742417-111742439 TTCAAGACCTTCAATCTTGGTGG + Intronic
1060544449 9:124452028-124452050 TTCAACAACTGCAAGTGTGAGGG + Intronic
1061241565 9:129377201-129377223 TTAAAGATCTTGAAATGAGGAGG + Intergenic
1186681226 X:11876128-11876150 GACAAGATCCTCAAGTGGGGAGG - Intergenic
1188659671 X:32743295-32743317 TTCAAGAGTTTAAACTGTGGTGG - Intronic
1189401391 X:40672310-40672332 TTAGAGATATTAAAGTGTGGGGG - Intronic
1190169496 X:48100684-48100706 TCCAAGGTCATCAAGTGTTGGGG + Intergenic
1197622402 X:128765246-128765268 TTAAAGATCATCTAGTTTGGGGG - Intergenic
1198888780 X:141369030-141369052 TTCTAGATTTTCAAGTTTGTTGG - Intergenic
1200273181 X:154706765-154706787 TTCAAATTAGTCAAGTGTGGTGG + Intronic