ID: 1097632006

View in Genome Browser
Species Human (GRCh38)
Location 12:62075535-62075557
Sequence CCTTATAGTTGTCTAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097632006_1097632010 14 Left 1097632006 12:62075535-62075557 CCTGTTCCTAGACAACTATAAGG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1097632010 12:62075572-62075594 TCAGATAAAAAGATTAAACTTGG 0: 1
1: 0
2: 3
3: 66
4: 452
1097632006_1097632011 15 Left 1097632006 12:62075535-62075557 CCTGTTCCTAGACAACTATAAGG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1097632011 12:62075573-62075595 CAGATAAAAAGATTAAACTTGGG 0: 1
1: 0
2: 1
3: 62
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097632006 Original CRISPR CCTTATAGTTGTCTAGGAAC AGG (reversed) Intronic
905224267 1:36468890-36468912 CCTTATTTTTGTCTGGGAAATGG + Intronic
909106109 1:71411145-71411167 CCTTATAGGTTTGTAGTAACTGG - Intronic
916786239 1:168089237-168089259 CCCTTTAGTTGTCTGAGAACAGG + Intronic
917036082 1:170748264-170748286 ACTTATAGTTCTCAATGAACAGG + Intergenic
917051441 1:170929163-170929185 CCTGACATTTGTCCAGGAACAGG + Intergenic
918467940 1:184840746-184840768 TGTTATAGTTGCCTAGGTACAGG - Intronic
918930148 1:190844315-190844337 TCTTGTAGTTGTCTAGAAATAGG + Intergenic
1062785664 10:262646-262668 CATTATAGATATCTAGGAAAGGG - Intergenic
1068347221 10:55796937-55796959 ACTTATTGTTTTGTAGGAACTGG + Intergenic
1070526198 10:77298031-77298053 CCTTGAAGTTGTCAAGAAACTGG + Intronic
1072771257 10:98140667-98140689 ATTTATAGTTGGCTAGGAAAGGG + Intronic
1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG + Intergenic
1076607009 10:131695667-131695689 CCTTCTGCTTGTCTAGGAAAGGG + Intergenic
1078327024 11:10389171-10389193 CCTTATAGTCCTTTAGGAACTGG - Intronic
1078468089 11:11565185-11565207 CCTTATAGACCTCTGGGAACAGG - Intronic
1079180524 11:18189539-18189561 CCATGTAGTTGACTAGGAAGAGG - Intronic
1081225534 11:40517623-40517645 CCTTATGGTGGTTTAGGCACTGG + Intronic
1081299281 11:41430453-41430475 TATAATAGTTGTCTAGGAACTGG - Intronic
1088249715 11:107852101-107852123 CCTTGTTATTGTCTAGCAACAGG - Intronic
1092755992 12:11763908-11763930 GCTTATAGTTGACTGTGAACGGG + Intronic
1093062404 12:14620852-14620874 TCTTAGAGTTCTCTAGGAACTGG + Intronic
1095157576 12:38877225-38877247 CTTTATACTAGTCTATGAACAGG - Intronic
1096587294 12:52631053-52631075 CCATATTATTGTCTAGGAACTGG - Intergenic
1097194830 12:57237532-57237554 CCTTAGAGCTGTCCAGGAGCGGG + Intronic
1097329891 12:58321438-58321460 CCTCATAATTGACTAGGAATGGG + Intergenic
1097632006 12:62075535-62075557 CCTTATAGTTGTCTAGGAACAGG - Intronic
1098506122 12:71252749-71252771 GCTTTTGGTTGTCTGGGAACGGG - Intronic
1098789988 12:74809813-74809835 ATTTAAAGTTGTCTAGGAATAGG + Intergenic
1102049527 12:109852620-109852642 CCGTGTAGTTGACTAGGAAGAGG + Exonic
1102778027 12:115537884-115537906 CCTTATAGCTCACAAGGAACTGG + Intergenic
1110849606 13:80230459-80230481 CCTTCTAGTAGCCTATGAACTGG - Intergenic
1114031840 14:18585650-18585672 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1114076611 14:19164679-19164701 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1114085554 14:19234889-19234911 CCTTGTAGTTACCTAGGGACTGG - Intergenic
1116638932 14:47436099-47436121 GGTTATAGTTGTCTACAAACTGG + Intronic
1120510262 14:85404790-85404812 GCTCATACATGTCTAGGAACAGG + Intergenic
1202897099 14_GL000194v1_random:16603-16625 CCTTTTAGTTACCTAGGGACTGG - Intergenic
1126056707 15:44736596-44736618 CCTTTTAGTTTTCAAGGAATGGG - Exonic
1127686978 15:61355723-61355745 CCTAATAGATGTGTAGGAATAGG - Intergenic
1127745271 15:61963594-61963616 CCTGAGAGTTATCTAGGAAGTGG - Intronic
1132564556 16:615632-615654 CCTTACAGTTTTATAGGAAAAGG - Intronic
1135522677 16:23189389-23189411 CCTTCTAGCTGACTTGGAACAGG + Exonic
1137841741 16:51647253-51647275 ACTTATAGTTGTGTTGGAATAGG + Intergenic
1143127519 17:4653057-4653079 CCTTCTGGTTGTTTAGCAACTGG - Intergenic
1144481409 17:15632536-15632558 TCTTATAGTTCTCCAGCAACTGG + Exonic
1144916892 17:18731186-18731208 TCTTATAGTTCTCCAGCAACTGG - Exonic
1150599050 17:66634416-66634438 CTTTTTAGTTCTCCAGGAACTGG - Intronic
1150767675 17:68015095-68015117 CCTTAAATTTGTCTATGAAGAGG + Intergenic
1159538710 18:69748243-69748265 CTTTATAGGTCTCTAAGAACTGG - Intronic
1165325981 19:35115026-35115048 CCTTACCCTTGTCTAGGACCTGG + Intergenic
925394367 2:3521880-3521902 CCATCTAGTTGTCTAGGGAGTGG - Intergenic
937958530 2:127437653-127437675 TCTTTTCCTTGTCTAGGAACTGG + Intronic
938491211 2:131762195-131762217 CCTTGTAGTTACCTAGGGACTGG + Intronic
938496352 2:131800142-131800164 CCTTGTAGTTACCTAGGGACTGG - Intronic
1172915504 20:38440480-38440502 CCTTATATTTTTCTAGGGGCAGG + Intergenic
1176616785 21:9032592-9032614 CCTTTTAGTTACCTAGGGACTGG - Intergenic
1176708343 21:10131055-10131077 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1180292419 22:10858304-10858326 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1180455954 22:15512707-15512729 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1180495225 22:15887726-15887748 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1180940210 22:19655869-19655891 CCTTTCAGTTGTCGAGGGACTGG - Intergenic
1181382953 22:22521389-22521411 CTTTATTCTTGTCTAGGGACTGG + Intergenic
949121781 3:393300-393322 CCTTATATTAGTCGATGAACTGG + Intronic
953977148 3:47390457-47390479 CCTGTTAGTTGTGTAGGTACTGG + Intronic
957536044 3:81504971-81504993 CGTTATAGTCGTCTAGTCACTGG - Intronic
959235227 3:103712400-103712422 TCTGATAGTAGTATAGGAACAGG - Intergenic
962776423 3:138665174-138665196 CCTTATGGCTGTTTAGCAACAGG - Exonic
975956735 4:79849554-79849576 CCTTATATTTGTCCAGTAGCTGG - Intergenic
976414327 4:84754405-84754427 CTTTATAGTTGTTTATGAATAGG + Intronic
978549174 4:109906231-109906253 CATTAGAGTTTTCTAGGTACAGG - Intergenic
980102870 4:128559095-128559117 CCATATAGTTTTCCATGAACAGG - Intergenic
981852693 4:149249810-149249832 CCTTTTATTTGTCCATGAACTGG + Intergenic
991214082 5:64141778-64141800 CCTTATAGTAATGTGGGAACAGG - Intergenic
992572506 5:78074186-78074208 CCTTTTAGTAATCTAGGAAAAGG + Intronic
997064467 5:130545340-130545362 CCTTAGAGATGTCTGGGATCAGG + Intergenic
999682102 5:154070090-154070112 ACTTATTGTTGACCAGGAACTGG - Intronic
1000843171 5:166247093-166247115 CCTTCTATCTGTCTAGAAACAGG - Intergenic
1005443386 6:25896298-25896320 TTTTATAGTTATGTAGGAACTGG + Intergenic
1009525415 6:64738588-64738610 CCTTATATTTGTATAGGAAATGG + Intronic
1012951872 6:105526811-105526833 CCTAATAGTTGTAGAGGAGCTGG - Intergenic
1020737549 7:11970145-11970167 CCTTCTAGATTTCTAGGAATAGG - Intergenic
1022855245 7:34307741-34307763 CCTTATATTTTTATAGGCACTGG - Intergenic
1045830053 8:106447978-106448000 CCTTATAGCTGTGTGGGAGCCGG - Exonic
1046530414 8:115438138-115438160 CCATATAGTTTTATAGGCACAGG + Intronic
1052194270 9:25693120-25693142 ACTTATATTTGTGTAGGTACTGG - Intergenic
1053645305 9:40116568-40116590 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1053760409 9:41346959-41346981 CCTTGTAGTTACCTAGGGACTGG - Intergenic
1054539267 9:66259403-66259425 CCTTGTAGTTACCTAGGGACTGG - Intergenic
1054795478 9:69297444-69297466 CTGCATAGTTGTCTTGGAACTGG + Intergenic
1057922558 9:99109202-99109224 CCTTAAAGTTCTCAAGGAAAAGG + Intronic
1058566192 9:106287723-106287745 CCTGAAATTTGTCGAGGAACAGG + Intergenic
1060890839 9:127187138-127187160 CCTCATAGGAGTCAAGGAACAGG + Intronic
1202793104 9_KI270719v1_random:100024-100046 CCTTGTAGTTACCTAGGGACTGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1187275238 X:17811065-17811087 CCTTCCAGCTGTCTAGGGACTGG - Intronic
1194961222 X:100238026-100238048 GCTTATCTTTGTCTAGGATCTGG - Intergenic
1201150187 Y:11091443-11091465 CCTTTTAGTTACCTAGGGACTGG - Intergenic