ID: 1097633120

View in Genome Browser
Species Human (GRCh38)
Location 12:62088439-62088461
Sequence CTGTCTGAGCAGAAGGACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097633120_1097633125 -2 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633125 12:62088460-62088482 AGAGACAAAGAACATGGAACCGG 0: 1
1: 0
2: 1
3: 49
4: 439
1097633120_1097633129 22 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633129 12:62088484-62088506 TCTTTGGTCTGCTAACACTGTGG 0: 1
1: 0
2: 0
3: 6
4: 155
1097633120_1097633126 -1 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633126 12:62088461-62088483 GAGACAAAGAACATGGAACCGGG 0: 1
1: 0
2: 1
3: 20
4: 290
1097633120_1097633124 -8 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633124 12:62088454-62088476 TCAGACAGAGACAAAGAACATGG 0: 1
1: 0
2: 7
3: 49
4: 587
1097633120_1097633130 29 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633130 12:62088491-62088513 TCTGCTAACACTGTGGTAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1097633120_1097633127 6 Left 1097633120 12:62088439-62088461 CCCCGGTCCTTCTGCTCAGACAG 0: 1
1: 0
2: 1
3: 21
4: 129
Right 1097633127 12:62088468-62088490 AGAACATGGAACCGGGTCTTTGG 0: 1
1: 0
2: 2
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097633120 Original CRISPR CTGTCTGAGCAGAAGGACCG GGG (reversed) Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
906071397 1:43019259-43019281 CTGTGTGCGCAGCAGGGCCGGGG + Intergenic
916023582 1:160815020-160815042 CACTCAGTGCAGAAGGACCGGGG - Intronic
919183713 1:194117960-194117982 CTGCCTGATCACAAGGACAGAGG + Intergenic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
921023645 1:211259034-211259056 CTCTCTGGGCGGAAGGAACGCGG - Intronic
922421824 1:225465629-225465651 CTGTCTGTGCACAAGAAACGAGG + Intergenic
922605458 1:226887303-226887325 CTGTGTGTGCAGCAGGGCCGTGG + Intronic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
1063025693 10:2177022-2177044 CTGTCGGAGCAGAAGGTCTGGGG - Intergenic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063366891 10:5496482-5496504 CTGACTGAGCAGGAGGCCTGCGG - Intergenic
1064885214 10:20103981-20104003 CTTTCAGAGCAGAAGGACATGGG + Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1071493036 10:86149295-86149317 CTGTCTGAGCAGAAGGCTCCTGG - Intronic
1072635732 10:97176650-97176672 CTGTCTGAGGAGGAGGTCCAAGG - Intronic
1073499797 10:103926155-103926177 CTGTGTCAGCAGAAGGCCCCAGG + Intergenic
1075542269 10:123324921-123324943 ATGGCTGAGCAGGAGGACAGAGG + Intergenic
1075978747 10:126719398-126719420 CTGGCTGAGCAGAAAGGCCGGGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1083888852 11:65585746-65585768 CTATCTGATCAGAGGGACCCTGG + Intronic
1084178460 11:67435216-67435238 CTGTGAGAGCAGCAGGACCCTGG + Exonic
1085519561 11:77130145-77130167 CTGACTGAGCAGAAGGTCAAGGG - Intronic
1085542431 11:77284797-77284819 TTATCTGAGTAGAAGGACTGTGG + Intronic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1089298364 11:117483054-117483076 TTGTCTGAGCAGTAGGGACGGGG - Intronic
1090991861 11:131824914-131824936 CTGACAGAGCAGAAGGAACACGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1096690148 12:53315518-53315540 CTTACTGGGCAGAAGGACCTGGG - Intronic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1099609441 12:84848929-84848951 CTGTCTGAGCAGAAGGGACCTGG - Intergenic
1101639428 12:106577114-106577136 CTGTCAGAGGTGAAGGGCCGGGG + Intronic
1104505806 12:129331071-129331093 CTGTCTGAGCACGAGGATCAAGG + Intronic
1108771633 13:53709115-53709137 ATATCTCAGCAGAAGGACCCTGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112323884 13:98430588-98430610 CTGTCTGAGCAGACGGGGCGAGG + Intronic
1113524858 13:110966854-110966876 CTGTCTGAGGGGAAAGACTGAGG - Intergenic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1122092776 14:99350969-99350991 CTGTCTGGACAGAGGGCCCGTGG + Intergenic
1125430796 15:39591359-39591381 CTGCCTGATCAGAGGGCCCGCGG + Intronic
1128562754 15:68679332-68679354 CTTTCTGAGCACATGCACCGGGG + Intronic
1130971762 15:88739354-88739376 CTGTCTGCCCAGATGGACCGAGG - Intergenic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1132343096 15:101090307-101090329 CTGTCTGTGCAGCTGGATCGTGG + Intergenic
1132626908 16:895544-895566 CTGTCTGTGCAGGACGACCTGGG + Intronic
1133253848 16:4504018-4504040 TTGCCTGAGCAGAAGCCCCGAGG + Intronic
1137491236 16:48934492-48934514 TTATGTGAGCAGAAGGACCGGGG + Intergenic
1138658522 16:58504110-58504132 ATGGCTGAGCAGAGGGGCCGGGG - Intronic
1138930391 16:61647827-61647849 CTGTCTGAAGAGAAAGACTGTGG - Exonic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143636149 17:8164606-8164628 CTGTCAGTGCACAAGGACCAGGG - Intergenic
1147718318 17:42522521-42522543 ATGTCTGAACAGGAGGACCTTGG - Exonic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1152727053 17:81952666-81952688 CTGTCTGAGCTGGTGGACTGAGG + Exonic
1154270163 18:12911846-12911868 CCGTCTGAGCTGGAGGACCGCGG + Intronic
1157684452 18:49631182-49631204 CAGTCTGAGCAGAAGATCCAAGG - Intergenic
1157692886 18:49698258-49698280 CTGACTGAGCAGAAGCTTCGGGG - Intergenic
1159366468 18:67472084-67472106 CTATGAGAGCAGAAAGACCGTGG - Intergenic
1160739541 19:679690-679712 CTGTCTGAGCAGCGGGGCTGCGG + Intronic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1161002054 19:1915460-1915482 CTGGCTGAGCAGAAGCTCCTGGG + Intronic
1161314570 19:3611819-3611841 CTGTCTGGGCTGCAGGGCCGCGG - Exonic
1164497590 19:28782155-28782177 CTGTCTCATCAGAATGACAGTGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165991644 19:39818590-39818612 CTGTCTGCTCAGAAGGGCTGTGG - Intergenic
1168011793 19:53538866-53538888 CTGCCTGAGAACAAGGGCCGCGG + Intronic
1168013829 19:53555495-53555517 CTGCCTGAGAACAAGGGCCGCGG + Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925808232 2:7673454-7673476 CTGGCAGAACTGAAGGACCGTGG + Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
933897299 2:86823599-86823621 CTCTCTGAGGATAAGGACCAAGG + Intronic
937883591 2:126885892-126885914 CTGTCTGTGGTGAAGGAGCGAGG - Intergenic
947556634 2:231099120-231099142 CTGTCTGAGCGGAAAGATTGGGG + Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
1168893590 20:1309255-1309277 CTGTCTGAACAAAAGGACAAAGG - Exonic
1170790855 20:19508372-19508394 ATGTCTGAGCAAAAGGAACATGG - Intronic
1174146264 20:48454856-48454878 ATGTCTGAGCAGATGGGCCTGGG - Intergenic
1174590840 20:51643540-51643562 CTCTCGCAGCAGAAGGAGCGAGG - Intronic
1180181863 21:46121664-46121686 CTGCCTGAGGAGCAGGACAGGGG + Intronic
1180660277 22:17461092-17461114 CTGGCAGAGCAGCACGACCGGGG - Intronic
1180682685 22:17639170-17639192 CTGTCTGTGGGGAAGGACAGCGG - Intronic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1182994735 22:34801624-34801646 CTGCCTTATCAGAAGGACAGAGG - Intergenic
1183679468 22:39319239-39319261 TTGTCTGGGTAGAAGGACCTTGG - Intronic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
1184767686 22:46580072-46580094 CTGTCTCTGCAGAAAGCCCGGGG + Intronic
1185343410 22:50301302-50301324 CTTTCTGACCCGAAGGACCACGG - Intronic
950294846 3:11820473-11820495 CTCTCGGAGAACAAGGACCGGGG + Intronic
952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG + Intergenic
953347069 3:42185100-42185122 CTCTCTGAGGACAAGGACTGTGG - Intronic
953747015 3:45583054-45583076 CTCTCTGAGCAGATGGCCCTGGG + Intronic
955480593 3:59385557-59385579 CTGTCTTATCACAAGGACAGAGG - Intergenic
956274111 3:67479507-67479529 CTGTCTGGGGAAAAGGACAGTGG - Intronic
962730837 3:138282051-138282073 CTGGCTGAGAAGTAGGAGCGGGG - Intronic
963797564 3:149646253-149646275 CTATCTGTGGTGAAGGACCGGGG + Intronic
968514159 4:1009535-1009557 CTGCCTGACCCGAAGGGCCGTGG + Intergenic
968753000 4:2399948-2399970 CTGTCTGAGGAGGAGGGACGTGG - Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
969697945 4:8745861-8745883 CTAGCTGAGCAGTAGGATCGGGG - Intergenic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
978361135 4:107931898-107931920 CTGGCTGAGCAGCAGGACCAGGG + Exonic
981423828 4:144581222-144581244 CTGTCTTATCACAAGGACAGTGG - Intergenic
991673937 5:69074510-69074532 CTGGCTGGGCAGAAGGATCCCGG - Intergenic
992194825 5:74328695-74328717 CTGTCAGAGCAGAGGGGCAGTGG + Intergenic
998506386 5:142675625-142675647 CTGTCTCAGCGGACGGACGGTGG - Intronic
1004057905 6:12159506-12159528 CTGGCTGAGGAGAAGGCCCTGGG - Intronic
1006739193 6:36295194-36295216 CTGTCTGCTAAGAAGAACCGAGG - Intronic
1007069213 6:39022737-39022759 GTGTCTGAACAGAAGGGCCTGGG + Intronic
1009348043 6:62641494-62641516 CTGTATGAGGAAAAGGACTGTGG - Intergenic
1010251660 6:73713615-73713637 GTGTCTGAGCAGTAGGACCCAGG + Intronic
1014325416 6:119986948-119986970 CTGTCTTATCAGAAGGACAGAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1017330972 6:153197998-153198020 CTCTATGAGCAGAACAACCGAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1022027911 7:26466040-26466062 GTGTCTGAGCAAAAGGAAAGAGG + Intergenic
1023798765 7:43814987-43815009 CTGTCTGAGGGGAAAGACTGGGG - Intergenic
1023845006 7:44115634-44115656 CTGTCTGAGGAGAAGTTCAGAGG - Intronic
1030150249 7:106397366-106397388 CTCTCTGAGTAGGAGGACTGAGG + Intergenic
1032268232 7:130383118-130383140 CTGTCCGAGCAGCAGAACAGGGG + Intronic
1032347953 7:131134318-131134340 CTGTCAGTGGAGAAGGACCCTGG - Intronic
1033098175 7:138448802-138448824 CTGTCTGAGGGGAAAGACTGGGG + Intergenic
1036105052 8:5829629-5829651 CTGCCTGAGAGGAAGGACTGGGG + Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1039028851 8:33287672-33287694 GAGTCTGAGCAGGAGGACCTGGG - Intergenic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1039356522 8:36823282-36823304 GTCTCTGAGCAGTAGGACTGGGG - Intronic
1039974901 8:42354581-42354603 CTGTCTGCCCAGAAGTACAGTGG + Intronic
1040782139 8:51121926-51121948 CTGCCTTATCAGAAGGACAGAGG - Intergenic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1048245513 8:132793086-132793108 CTGTCAGAGCAGCAGGAGCCGGG + Intronic
1048804814 8:138230189-138230211 GTGGCTGATCAGAATGACCGTGG - Intronic
1049258050 8:141624374-141624396 CTGTCTGAGCATTAGGGCTGGGG - Intergenic
1049746863 8:144266677-144266699 CTGTCGGAGGACGAGGACCGCGG + Exonic
1051361672 9:16286443-16286465 CCCACTGAGCAGAGGGACCGAGG + Intergenic
1052218258 9:25991989-25992011 CTATCAGAGCAGGAGGACCTAGG - Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1185569716 X:1124194-1124216 CGGAGTGAGCAGAAGGACAGAGG + Intergenic
1185889380 X:3810775-3810797 CTGTCCAAGGAGAAGGACCCTGG - Intergenic
1194909613 X:99624903-99624925 CTGTCTGAGGAGAAGTACCTAGG + Intergenic
1195914462 X:109922431-109922453 CTGTCTAAGCAGTAGCACTGGGG - Intergenic
1200334455 X:155335026-155335048 CTGTGTGAGCAGTAGGATTGGGG - Intergenic
1200763593 Y:7062114-7062136 CTGTCTGAGGGGAAAGACTGGGG + Intronic