ID: 1097635178

View in Genome Browser
Species Human (GRCh38)
Location 12:62113756-62113778
Sequence GCCGCCAGGAAGTTTAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2975
Summary {0: 2, 1: 11, 2: 182, 3: 742, 4: 2038}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097635178_1097635181 -5 Left 1097635178 12:62113756-62113778 CCCAGTTTAAACTTCCTGGCGGC 0: 2
1: 11
2: 182
3: 742
4: 2038
Right 1097635181 12:62113774-62113796 GCGGCTTTGTTTACAATGTGAGG 0: 4
1: 82
2: 595
3: 474
4: 323
1097635178_1097635182 -4 Left 1097635178 12:62113756-62113778 CCCAGTTTAAACTTCCTGGCGGC 0: 2
1: 11
2: 182
3: 742
4: 2038
Right 1097635182 12:62113775-62113797 CGGCTTTGTTTACAATGTGAGGG 0: 5
1: 81
2: 662
3: 459
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097635178 Original CRISPR GCCGCCAGGAAGTTTAAACT GGG (reversed) Intronic
Too many off-targets to display for this crispr