ID: 1097637346

View in Genome Browser
Species Human (GRCh38)
Location 12:62138947-62138969
Sequence CCTTATTTCTGATCTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097637346_1097637350 8 Left 1097637346 12:62138947-62138969 CCACCCAGAGATCAGAAATAAGG 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1097637350 12:62138978-62139000 ACAGTTTCCTTCCTTTTCCATGG 0: 1
1: 0
2: 9
3: 55
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097637346 Original CRISPR CCTTATTTCTGATCTCTGGG TGG (reversed) Intronic
901304810 1:8225134-8225156 CCTTATTCCTGATCCTGGGGAGG + Intergenic
903528560 1:24011989-24012011 CCTTAGTTTTGTTCTCTGGAAGG - Intergenic
909434910 1:75630068-75630090 CATTGTTTCTGATATCTGTGGGG + Intergenic
909881965 1:80891116-80891138 CCTTATTTCTGCTCTCTCAGAGG + Intergenic
909890940 1:81005847-81005869 CCTCTGTTCTGCTCTCTGGGAGG + Intergenic
910735595 1:90452552-90452574 CCTTATTTCTGATCTTAGTAAGG - Intergenic
912304858 1:108557047-108557069 CCTACTTTCTGATCTCTTGGTGG - Intergenic
915308758 1:154996570-154996592 GCTTATTTCTTATCCCTGGCAGG + Intergenic
915981718 1:160424523-160424545 ACTTATTTCTCATCTCTATGAGG + Intronic
917692511 1:177483858-177483880 CCTTTTCTCTGCTCTCTTGGAGG - Intergenic
917796269 1:178534892-178534914 CCCTATTCCTGATCTCGTGGTGG + Intronic
919018934 1:192078037-192078059 CCTTTTCCCTGATTTCTGGGAGG - Intergenic
919209390 1:194459368-194459390 CTTTATTTCTGTTCTCTGTTTGG + Intergenic
919508132 1:198426115-198426137 CCTCATTTCTGTTTCCTGGGAGG + Intergenic
919769772 1:201149988-201150010 CCTTAATTCTGACTTCTGAGGGG + Intronic
920173310 1:204084721-204084743 CCTGGTCACTGATCTCTGGGCGG - Intronic
921389638 1:214605640-214605662 CCTTATTGCTGAGGTCTGGCCGG + Intronic
922641776 1:227239841-227239863 CCTTATTCCTGAACTGAGGGAGG - Intronic
923095399 1:230771441-230771463 CCTTATTTCAGGTGTCTGTGAGG - Intronic
923407214 1:233673886-233673908 CCGAATTTCTGTTCTCTGAGAGG - Intergenic
1063537260 10:6896092-6896114 CCTTGCTTCTGATCCCAGGGAGG - Intergenic
1066138573 10:32478375-32478397 CCTTCTTCCTGATCTTAGGGAGG + Intronic
1067688991 10:48489012-48489034 CCTTGTTTCCCATCTCTTGGGGG + Intronic
1068811472 10:61260250-61260272 TCTTTTATCAGATCTCTGGGTGG + Intergenic
1070981518 10:80652275-80652297 CCCTCCTTCTGATCTCTGGCTGG + Intergenic
1073344710 10:102774221-102774243 CCTCATTGCTGTTCCCTGGGCGG + Intronic
1073599985 10:104837188-104837210 CCTGATTTCTGACCTCAAGGAGG + Intronic
1073600579 10:104842427-104842449 CCTATCATCTGATCTCTGGGTGG + Intronic
1073680109 10:105693930-105693952 CCTTCTTTATGATCTTTGGTTGG + Intergenic
1075372966 10:121953475-121953497 CCTTATTTCTGTGCTGAGGGTGG - Intergenic
1078816072 11:14823553-14823575 CCCTATTTCTCCTCACTGGGTGG + Intronic
1079789110 11:24713508-24713530 CCATATTTCTGATCTTTGGATGG - Intronic
1080523598 11:33090266-33090288 CCTTATATCTTATATCTGGTGGG - Intronic
1082776832 11:57251814-57251836 CCTTTTTTATCAGCTCTGGGAGG + Intergenic
1082962053 11:58927799-58927821 CCTTTTTTCTTATCTATTGGAGG + Intronic
1083424505 11:62576122-62576144 CCTGCCTTCTAATCTCTGGGAGG - Exonic
1085644003 11:78210763-78210785 CCTTTGATCTGATCTCTTGGTGG + Intronic
1086209390 11:84300385-84300407 CCTTGTGTCTGTTCTCTGGAAGG - Intronic
1087254824 11:95941670-95941692 CCATATTTCTTTTCTCTGGGAGG + Intergenic
1090704472 11:129324131-129324153 CCTTCTCTCTGTTCTCTGGTGGG + Intergenic
1092213919 12:6667304-6667326 CCTTTTCTCTGTTATCTGGGAGG + Exonic
1093519820 12:20035606-20035628 CCTTGTTTCAGTTCTCTGGGAGG + Intergenic
1096377077 12:51121437-51121459 CCTGACTTCTGATCTTTTGGGGG - Intronic
1096414292 12:51400180-51400202 CTTTCCTCCTGATCTCTGGGTGG - Intronic
1097248129 12:57617852-57617874 CCTTATCTTTGCTCTCTGCGAGG + Intronic
1097396907 12:59086278-59086300 CCTAATTAATCATCTCTGGGTGG - Intergenic
1097637346 12:62138947-62138969 CCTTATTTCTGATCTCTGGGTGG - Intronic
1099501122 12:83415359-83415381 GCTTCTCCCTGATCTCTGGGAGG + Intergenic
1099685896 12:85888702-85888724 CCTTATTCCTGATCTTAGTGGGG - Intergenic
1099721953 12:86374643-86374665 CCTTATTTCTGATCTCAGCTTGG - Intronic
1100127125 12:91440848-91440870 CACTATTACTGATATCTGGGAGG - Intergenic
1103844344 12:123891088-123891110 CGTTCCTTCTGAGCTCTGGGTGG + Intronic
1105974769 13:25463926-25463948 TCTTATTGCTGGTCTCTGGTGGG + Intronic
1110603379 13:77402243-77402265 CCTTAATTCTATTCTCTAGGTGG + Intergenic
1112093922 13:96111555-96111577 CTTTTTTTCTGACCTCTGGAAGG + Intronic
1115155785 14:30337402-30337424 CCTTATTCCTCATTTTTGGGAGG - Intergenic
1118347304 14:64949767-64949789 ATTTCTTTCTGCTCTCTGGGAGG + Intronic
1119418441 14:74492062-74492084 TCTTCTTGCTGACCTCTGGGTGG - Intronic
1120243742 14:81981464-81981486 CCTTTATTCTGATCTCAGCGTGG + Intergenic
1121337104 14:93084118-93084140 CCTTGTTTCTGAGGTCAGGGAGG - Intronic
1124868175 15:33514493-33514515 CCTGAGTCCTGCTCTCTGGGTGG + Intronic
1126469720 15:48995538-48995560 CTTTTTTTCTTTTCTCTGGGAGG - Intronic
1127833494 15:62771254-62771276 GATTATTTCTGATCTCAGAGTGG - Intronic
1129425813 15:75461952-75461974 CGTAATTTCTGATTTCTGGGTGG + Intergenic
1129703623 15:77782356-77782378 CCTTCTTTCAGATCCCTGCGTGG - Intronic
1132140982 15:99394910-99394932 TCTTATTTGTGATCTCTGGGGGG - Intergenic
1132597959 16:761820-761842 CCCCATTTCTGAGCTGTGGGTGG + Intronic
1133068048 16:3224139-3224161 CCTTATTCCTGTTCTCAGTGTGG - Exonic
1135877403 16:26215935-26215957 CCTCATCCCTGATCCCTGGGAGG - Intergenic
1138561155 16:57801897-57801919 CCTTCTTCCTAACCTCTGGGCGG + Intronic
1139243018 16:65413256-65413278 CCTCATTTTTAATCTCTGAGAGG - Intergenic
1139250546 16:65491228-65491250 CTTTATTTCTGATAAATGGGGGG + Intergenic
1140451418 16:75074014-75074036 CTTTATCTCTGCTCTCCGGGTGG - Intronic
1140453519 16:75090552-75090574 CTGTATTTCTAACCTCTGGGTGG - Intronic
1142131139 16:88432009-88432031 CCATTTTCCTGATCTCTCGGGGG + Exonic
1144784664 17:17824889-17824911 CCTTATTTCCCAGCTTTGGGAGG + Intronic
1145950053 17:28809911-28809933 CCTTCTATTTGATATCTGGGTGG - Intronic
1146464051 17:33072233-33072255 GCTTATTTCTCATCTCTTTGGGG + Intronic
1148790285 17:50168885-50168907 CATGATCTCAGATCTCTGGGAGG + Intronic
1149687855 17:58548225-58548247 ACTTATTTCTGAGCTCTTGGGGG + Intergenic
1150300713 17:64044859-64044881 CCTTATTTCTCATGGCTCGGAGG + Exonic
1150959864 17:69901390-69901412 CCTTCTTTCTCATTTCTGGTGGG + Intergenic
1154454813 18:14510979-14511001 CCACATTTCTAATCACTGGGTGG - Intronic
1155905866 18:31450454-31450476 CATTATTTCAAAACTCTGGGTGG - Intronic
1156494986 18:37519840-37519862 CCTGATTCCTGTCCTCTGGGAGG + Intronic
1156763480 18:40622073-40622095 CCTTATTTCAAAGCTCTTGGAGG + Intergenic
1159210653 18:65316999-65317021 GCTGATTTCTGAGCTCTGGGGGG + Intergenic
1162827388 19:13261753-13261775 GCTTATTTCTGAAAGCTGGGGGG - Intronic
1166891876 19:45999082-45999104 CCTAAATTCTGCTCTCTGGTGGG - Intronic
1167559964 19:50221014-50221036 CCTTGTCCCTGATTTCTGGGTGG + Intronic
1168222064 19:54967594-54967616 TTTTATTTCTGTTCTCTTGGGGG + Intronic
925172079 2:1756213-1756235 CCTTAGTTCTTCTCTCTGTGGGG - Intergenic
925919191 2:8627667-8627689 CTTTTTTTCTGCTCTCTAGGGGG - Intergenic
926956872 2:18311349-18311371 CTTTATTTCTCACCTGTGGGAGG + Intronic
927001714 2:18802321-18802343 ACTTATTTCTGAACTCTCTGTGG + Intergenic
927356032 2:22174100-22174122 CCCTTATTCTGCTCTCTGGGAGG + Intergenic
927463055 2:23316009-23316031 CCCTGATTCTGTTCTCTGGGAGG - Intergenic
928655279 2:33444556-33444578 CATTATTTATGAGCTGTGGGTGG - Intronic
929168132 2:38904329-38904351 CCTCATTTCTGATGTGTAGGAGG - Intronic
930356143 2:50323270-50323292 CCTGATTTATGAGGTCTGGGTGG + Intronic
931183015 2:59922472-59922494 CTTAAATTCTGTTCTCTGGGAGG - Intergenic
935070644 2:99690849-99690871 CCTTCTTTCTGTTTTCTTGGTGG + Intronic
935337226 2:102027523-102027545 ACTTATTTCTAATCTTTGTGGGG + Intronic
936040422 2:109145483-109145505 CCTCCTTTCTCATCTGTGGGAGG + Intronic
938207258 2:129434485-129434507 CCCTATTGCTGACCCCTGGGTGG - Intergenic
939438986 2:142218653-142218675 CCTCATTTCTGCTCTCTATGGGG + Intergenic
939610764 2:144307387-144307409 CCTTGTTTCTAATCCCAGGGAGG - Intronic
940551944 2:155170002-155170024 CTTTATTTCTGATTTCAGGTTGG - Intergenic
943086755 2:183321705-183321727 CCTTATTTCTGAATTGAGGGAGG - Intergenic
944365314 2:198912479-198912501 CTTTTTTTCTAATTTCTGGGAGG - Intergenic
944744150 2:202638426-202638448 CTTTTTCTCTGATCTCTAGGAGG + Intronic
944985106 2:205167243-205167265 GCTTATTTATGATTGCTGGGGGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945198542 2:207259393-207259415 CTTTATTTCTGATCTTTAGAGGG - Intergenic
947863635 2:233380622-233380644 CCTTGTTTCTGAACTGGGGGTGG - Intronic
948455114 2:238101281-238101303 CCTCAACTCTGACCTCTGGGCGG - Intronic
1169500410 20:6154891-6154913 GCTTATTTCTTATCTTTGGCTGG + Intergenic
1171237991 20:23543542-23543564 CCTGATTTCTGATCTCAGCCAGG - Intergenic
1172879085 20:38186748-38186770 TCTTGTTCCTGATCTTTGGGAGG + Intergenic
1174883854 20:54310089-54310111 CCTGATTTCTAATCTCTGTTGGG - Intergenic
1177415266 21:20784831-20784853 CTTTATTTCTTCTCTCTGAGAGG - Intergenic
1178245742 21:30949804-30949826 CCTTATTTCTGATCTTTGGTTGG - Intergenic
1178625713 21:34216781-34216803 CCTTAGTCCTGCTCACTGGGTGG - Intergenic
1179484072 21:41698394-41698416 CCTCATCTGTGACCTCTGGGTGG + Intergenic
1181018345 22:20084505-20084527 CCTTAACCCTCATCTCTGGGTGG + Intronic
1181333739 22:22114809-22114831 CCTTATTGCTGAGGTCTGGCCGG + Intergenic
1182150405 22:28023396-28023418 CCTTTGTTCTGATCTCTGAATGG - Intronic
1183043668 22:35202588-35202610 CATCATCTCTGATCTCTGGCTGG + Intergenic
1183489831 22:38110415-38110437 CCTGATTTCTGTGCCCTGGGAGG + Intronic
1184932498 22:47691692-47691714 CATTATTCCTGGTGTCTGGGAGG + Intergenic
1185155248 22:49189746-49189768 CCTTATCTCTGCCCTCAGGGAGG - Intergenic
950546323 3:13640144-13640166 CCTCAGTTCTGACCTCTGCGAGG - Intergenic
951929005 3:27942623-27942645 CATTGTTTCTGATCACTGTGGGG + Intergenic
953890195 3:46745757-46745779 CCTTATTCCTGGTCTCTGGTGGG - Intronic
954568803 3:51623283-51623305 TCTTATTTCTGATCTTTGATTGG + Intronic
955611079 3:60758037-60758059 CCTCCCTTCTGATCTCTGGCTGG - Intronic
956761963 3:72451638-72451660 CCTCATTTCTCCTCTCTGGCGGG - Intergenic
957320263 3:78621078-78621100 CATTATTTTTCATTTCTGGGTGG + Intronic
958415347 3:93867428-93867450 CCTTATTCCTGACCTCTTTGGGG - Intergenic
959648918 3:108732670-108732692 CCAAACTTCTGCTCTCTGGGAGG + Intergenic
960313702 3:116149610-116149632 CCTATTTTCTGATCTTTTGGGGG + Intronic
960676369 3:120199366-120199388 CCTAATTTCAGATCCCTGGTTGG + Intronic
962516691 3:136158534-136158556 CCTTGTTCCTGATCTTTGGAAGG - Intronic
962548589 3:136464659-136464681 CCTTTTTTCTGAAATCTGAGAGG - Intronic
962822294 3:139061888-139061910 CCTTTTTTCCGATCTTGGGGAGG + Intronic
963099294 3:141583701-141583723 CCTTAAGTCTGAGCTCTGGCAGG + Intronic
963722892 3:148884185-148884207 TCTTAAATCTGATATCTGGGGGG - Intronic
965245648 3:166263507-166263529 CCTTATTTCAGATATCAGGCAGG + Intergenic
969626009 4:8306192-8306214 CCTTCGTCCTGATCTCGGGGGGG - Exonic
973112516 4:46413196-46413218 CCTCATTTCTGGCCTCTTGGAGG + Intronic
973153856 4:46923466-46923488 AAATATTTCTGATTTCTGGGTGG + Exonic
973976470 4:56267922-56267944 CCTTAGTTCTGAGAACTGGGAGG - Intronic
974030416 4:56771583-56771605 CATTATTTGTCATCTCTGGTGGG - Intergenic
975852539 4:78587466-78587488 TCTTATTCCTGATTCCTGGGAGG - Intronic
976088615 4:81431455-81431477 CCTTATCCCTCATCACTGGGAGG + Intronic
981267068 4:142798536-142798558 CCTTATTCCTCATGTTTGGGGGG - Intronic
983786241 4:171733102-171733124 CCTTCTGTCTCATCTCAGGGTGG + Intergenic
983831025 4:172328964-172328986 GGTTCTTTCTCATCTCTGGGTGG + Intronic
983871669 4:172831320-172831342 CCTTGTCTCTGCTCTCTGAGTGG + Intronic
984001660 4:174253525-174253547 CCTTGTTTCTGGTCTCTGCTGGG - Intronic
984579036 4:181488391-181488413 CCTGATTTCTCATCTCTGTGGGG + Intergenic
986911337 5:12561738-12561760 CCTTGTTCCTGATCTCAGGGGGG + Intergenic
990432557 5:55750846-55750868 CCTTATTTCTAATGACTGTGTGG + Intronic
991262727 5:64684522-64684544 TGTTATTTCTAATCTCTGAGAGG - Intergenic
991919785 5:71644487-71644509 TCTTTTTTCTGATGTCTTGGAGG - Intronic
992433804 5:76735907-76735929 CCTGATTGCTAGTCTCTGGGGGG - Intergenic
995404870 5:111783504-111783526 CATTATTTCTGATCTCAAGGAGG + Intronic
996635106 5:125679690-125679712 CCTTCTTTTGGATCTCTGGTGGG - Intergenic
999505592 5:152192554-152192576 CCTTATTCCTGAGCTTTGTGGGG + Intergenic
1001288826 5:170442242-170442264 CCTTTTCTCTGATCTCTGAAAGG - Intronic
1002785965 6:400666-400688 CCTTAATGGTGATTTCTGGGTGG - Intronic
1003732853 6:8845526-8845548 GCTTATTTCTGATTTCTGGCAGG + Intergenic
1004424512 6:15498268-15498290 CCTTTTTTCTGAGCTCTGGCTGG + Intronic
1004947079 6:20627433-20627455 ACTTATTTATGATCCCTGGGAGG + Intronic
1005795443 6:29356074-29356096 ACTTATTTCTGTACTTTGGGAGG - Exonic
1005806650 6:29479534-29479556 CCTTTTTTCTCATACCTGGGAGG + Intergenic
1005959098 6:30683799-30683821 CCTTCTCTCTGATCTTTGGCCGG + Intronic
1006143684 6:31945836-31945858 CCTTATTTCTGGTCCCTAAGTGG + Exonic
1006910101 6:37558071-37558093 CCTTCCTTCTGAACTCTGAGTGG + Intergenic
1008448342 6:51619506-51619528 CCTTCATTCTCATATCTGGGGGG + Exonic
1010325128 6:74555246-74555268 CCTTATTTCTGACTTCCGGATGG + Intergenic
1011667008 6:89643992-89644014 TCTTCTTTCTGTTCTATGGGTGG + Exonic
1012938052 6:105388569-105388591 CCTTCCTTCTGATCTCCGGATGG - Intronic
1014492884 6:122083452-122083474 ACTTATTTCTGTTCTTTGAGTGG - Intergenic
1015703440 6:136061513-136061535 CCTTATTTCTTATATGGGGGTGG - Intronic
1015804898 6:137099097-137099119 CTATTTTTCTGATCTCTGGAAGG - Intergenic
1016373850 6:143400616-143400638 CCTGATATCTGATCTCAGGATGG + Intergenic
1016610030 6:145978712-145978734 CCTTGTTGCTAGTCTCTGGGTGG - Intergenic
1016786369 6:148015051-148015073 CCTTAGTCCTACTCTCTGGGAGG - Intergenic
1017530428 6:155285350-155285372 CATTATTTCTGAACACTAGGTGG + Intronic
1018526622 6:164718056-164718078 CCTTGTTTCTGATCTCAGTAGGG - Intergenic
1018624220 6:165762059-165762081 GCTTATTTATACTCTCTGGGAGG - Intronic
1020335768 7:7061446-7061468 TATTATTTCTGATATCGGGGCGG + Intergenic
1021925647 7:25531291-25531313 CCTCATTTCTGCTTTCTGGAAGG + Intergenic
1022313048 7:29215424-29215446 CCTTAATTGGGACCTCTGGGAGG - Intronic
1023294136 7:38697698-38697720 CGATATTTCTGATTTCTGGTTGG - Intergenic
1023335067 7:39160308-39160330 GCTTATTTCAGAGCTCTGGTAGG + Intronic
1026116014 7:67496278-67496300 CCTCCTTGTTGATCTCTGGGAGG + Intergenic
1027183707 7:75957125-75957147 CCTCATTTCTGCTCTCAGAGAGG + Intronic
1027390897 7:77702541-77702563 CTTCATTTCTTTTCTCTGGGTGG + Intronic
1028063956 7:86357802-86357824 CCTTATTCTTGATCTCTTCGTGG - Intergenic
1028213874 7:88108158-88108180 CTTTATTTCTGTTTTCAGGGAGG + Exonic
1028418312 7:90603965-90603987 GCTTCTTTCTAATATCTGGGAGG + Intronic
1030650135 7:112108896-112108918 CCTTATTTCTGAGCACTGCCAGG + Intronic
1033612389 7:142976378-142976400 CCTTGTTTCTGATCTTATGGGGG - Intergenic
1034201346 7:149285006-149285028 TCTGGTTTCTGCTCTCTGGGAGG + Intronic
1034420939 7:150990357-150990379 CCTTCTCCATGATCTCTGGGTGG - Intergenic
1039548745 8:38428555-38428577 CCTTAGTGATGATCTCTTGGTGG + Intronic
1039746004 8:40427912-40427934 CCTCAGTTGTGAGCTCTGGGAGG + Intergenic
1039768299 8:40654869-40654891 TCTTATTTCTGATCTTAGGGAGG - Intronic
1040613378 8:49009351-49009373 CCTTATTTCTGCTCAGTGGAGGG + Intergenic
1040728984 8:50419567-50419589 CCTTATTACTGCTCTCTGAGAGG - Intronic
1040759359 8:50820188-50820210 TCTTATTTCTGATCTTAGGTAGG + Intergenic
1041432329 8:57796700-57796722 CCTTATTGCTGATATGTAGGAGG + Intergenic
1043710520 8:83411493-83411515 CCTCATTTCTGGTTCCTGGGAGG - Intergenic
1044742676 8:95343706-95343728 CCTTCTTTTTGATCCCTTGGAGG + Intergenic
1047797125 8:128268930-128268952 CCTCATCTCTGGTCTCTGTGAGG + Intergenic
1047926964 8:129691548-129691570 TCTTAAGGCTGATCTCTGGGAGG - Intergenic
1048573638 8:135674497-135674519 GCTTTTTTCTCATCTCTGGTTGG + Intergenic
1051498273 9:17749164-17749186 TCCTATTTCTCATCTCTGGATGG + Intronic
1051874997 9:21783284-21783306 ACTTAATTCTGATTTGTGGGTGG - Intergenic
1059618901 9:115981612-115981634 CCTTATTTCTGAAGTCAGGAGGG + Intergenic
1059838288 9:118182318-118182340 GCTTATTTCTGATTATTGGGAGG - Intergenic
1061201993 9:129143357-129143379 CCTTCTTTCTGTTCTCAGGCTGG + Intronic
1187691407 X:21871587-21871609 ACTAATTTCTGATATCTGGTTGG + Intronic
1188444258 X:30240078-30240100 CCTCCTATCTGATCTCAGGGAGG + Intergenic
1193786399 X:85764829-85764851 CTTTTTTCCTGCTCTCTGGGTGG - Intergenic
1196065587 X:111460684-111460706 CATTATTTCTGAGATCTGGGTGG + Intergenic
1198259282 X:134951526-134951548 CCAGATTTCTCTTCTCTGGGTGG + Intergenic
1199251952 X:145673883-145673905 CCTCATTTCAGGGCTCTGGGAGG + Intergenic
1199894276 X:152116688-152116710 CCTGTTTTCAGATCTCGGGGAGG - Intergenic
1200050998 X:153431668-153431690 CTTTATGCCTGAACTCTGGGAGG + Intergenic
1201325746 Y:12755942-12755964 CCTTATTACTGCTATGTGGGGGG + Intronic