ID: 1097639344

View in Genome Browser
Species Human (GRCh38)
Location 12:62160748-62160770
Sequence TAATGGGTATAGAACGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097639344_1097639351 22 Left 1097639344 12:62160748-62160770 CCTCCCACGTTCTATACCCATTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1097639351 12:62160793-62160815 GTCCCAGTCTAAGTGAGTGTAGG 0: 3
1: 18
2: 59
3: 106
4: 176
1097639344_1097639350 0 Left 1097639344 12:62160748-62160770 CCTCCCACGTTCTATACCCATTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1097639350 12:62160771-62160793 GGTAAATCATCATATCTAAATGG 0: 1
1: 0
2: 0
3: 14
4: 191
1097639344_1097639355 26 Left 1097639344 12:62160748-62160770 CCTCCCACGTTCTATACCCATTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1097639355 12:62160797-62160819 CAGTCTAAGTGAGTGTAGGTGGG 0: 1
1: 0
2: 3
3: 13
4: 117
1097639344_1097639354 25 Left 1097639344 12:62160748-62160770 CCTCCCACGTTCTATACCCATTA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1097639354 12:62160796-62160818 CCAGTCTAAGTGAGTGTAGGTGG 0: 1
1: 0
2: 5
3: 20
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097639344 Original CRISPR TAATGGGTATAGAACGTGGG AGG (reversed) Intronic
901289051 1:8108132-8108154 TAATGGGTTTAGAACCAGGCAGG - Intergenic
902641749 1:17771054-17771076 TAAAGCGTATAGAACAGGGGCGG + Intronic
908498051 1:64714732-64714754 TAAGGGGTATAGAGCGTAGAGGG - Intergenic
910775886 1:90874414-90874436 TAATGGGTATATAGCATGTGTGG + Intergenic
913571266 1:120122232-120122254 TAAGGGGTCTAGAGGGTGGGTGG + Intergenic
917895664 1:179484615-179484637 TGATGGGTAGAGTACATGGGCGG - Intronic
920248348 1:204605374-204605396 TAAGGGGTATAGGAAGTGAGAGG + Intergenic
920845445 1:209589515-209589537 AGATGAGTATAGAAGGTGGGTGG - Intronic
923743140 1:236674414-236674436 AAATGGGACTAGAACCTGGGTGG + Intergenic
1065269172 10:24009206-24009228 TTTTGGGTATAGAATGTGGTAGG + Intronic
1069099019 10:64295200-64295222 TAATGGGTAAAGAACTTCTGGGG - Intergenic
1092055957 12:5508125-5508147 TCATGGGTATGGGACCTGGGCGG - Intronic
1094077053 12:26488733-26488755 TAATGGGGTTAGAAGGTGGAAGG + Intronic
1097639344 12:62160748-62160770 TAATGGGTATAGAACGTGGGAGG - Intronic
1104406851 12:128525061-128525083 TTAGAGGTATAGAAGGTGGGAGG - Intronic
1104749988 12:131232156-131232178 TAATGTGTATGGAACATGGAAGG - Intergenic
1104782727 12:131432288-131432310 TAATGTGTATGGAACATGGAAGG + Intergenic
1110942944 13:81373806-81373828 TAACGTGTATAGAGCATGGGAGG + Intergenic
1111444384 13:88327162-88327184 AAATGGGTATAGAAGATGGATGG - Intergenic
1113495922 13:110729015-110729037 GAATGGGAATAGAATGTGTGAGG + Intergenic
1114412741 14:22516127-22516149 TAATTAGGTTAGAACGTGGGAGG - Intergenic
1114923983 14:27369942-27369964 TATTGGGAATAAAACGTGGTAGG + Intergenic
1117249343 14:53920136-53920158 TAATGGGTATAGAAACTTGCAGG - Intergenic
1132175244 15:99708893-99708915 GAATGGGGACAGAGCGTGGGTGG + Intronic
1133659308 16:7900626-7900648 TGATGGGTATACATAGTGGGTGG + Intergenic
1146282055 17:31550886-31550908 TATGGGGTATAGAATGAGGGAGG - Intergenic
1148147141 17:45373161-45373183 AAATGGGGAGAGAATGTGGGTGG - Intergenic
1148274037 17:46287686-46287708 TAACGGGTAGGGAACGTGGAAGG + Intronic
1151752118 17:76045236-76045258 CAATGCTTATAGAACCTGGGAGG + Intronic
1153191493 18:2545437-2545459 TAATAAGGATAGAAAGTGGGTGG + Intronic
1153374883 18:4364520-4364542 TAATGGCAATAAAACATGGGAGG + Intronic
1158190858 18:54827296-54827318 TAATGTGTGTAGAACGTGCCTGG - Intronic
1167972337 19:53196497-53196519 GAATGGGTGTAGAATGTGGAGGG - Intergenic
1167979324 19:53259927-53259949 AAATGGGCATAGCATGTGGGTGG + Intronic
1168599854 19:57708879-57708901 TGATGGCTTTAGAACGTGGGTGG + Intronic
927392510 2:22611178-22611200 TAATGGAAATAGAAAATGGGAGG - Intergenic
927937589 2:27084346-27084368 CAATGGGTAAGGAAGGTGGGTGG - Intronic
933322318 2:80792342-80792364 TAATGGGAAGATAATGTGGGTGG + Intergenic
935161590 2:100534100-100534122 CACTGGGTATAGAACATGGTAGG + Intergenic
935607754 2:104987338-104987360 TAATGGGAAGAGAATGGGGGAGG + Intergenic
937018212 2:118626023-118626045 AAATGGGTATACATTGTGGGTGG - Intergenic
937822457 2:126326271-126326293 TAATGGGAATAGAACCAGGAAGG - Intergenic
943294694 2:186122034-186122056 TTATGGGTAAAGAAGGGGGGTGG + Intergenic
947772178 2:232679164-232679186 AAATGGGTTTAGAACCTCGGGGG + Intronic
1169163779 20:3406097-3406119 TAAAGGATAGAGAAGGTGGGGGG - Intronic
1171272079 20:23825313-23825335 TCATGTGTGTAGATCGTGGGCGG - Exonic
1173790956 20:45827427-45827449 TAATGGGTTCAGACTGTGGGAGG - Intronic
1177363627 21:20104924-20104946 TTATGGGTACAGGATGTGGGTGG - Intergenic
1178017577 21:28367547-28367569 TCATGGGTATAGAGAGTGGAAGG - Intergenic
1179878178 21:44281958-44281980 TGATGTGTATAGAAGTTGGGAGG - Intergenic
1180152016 21:45953586-45953608 TAATGGGTATTGAACCTTGTGGG + Intergenic
1183213593 22:36465650-36465672 TAATGTGTTTAGAAAGTGCGTGG + Intergenic
955292786 3:57707846-57707868 TAATGGGTATGGAAAGTAGATGG + Intergenic
960668763 3:120136572-120136594 TCATGGATATAGAAAGTGGAAGG + Intergenic
963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG + Intronic
967365930 3:188686434-188686456 TAATGGGCATAGATACTGGGTGG + Intronic
967788201 3:193520044-193520066 TGCTGGGTAAACAACGTGGGAGG - Intronic
972913037 4:43842122-43842144 TAATTTGTATATAACATGGGAGG - Intergenic
987023379 5:13898192-13898214 TTATGGGTAAAGAACTTGAGTGG - Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
996529494 5:124512601-124512623 TCATTGGGATAAAACGTGGGGGG + Intergenic
997858454 5:137394569-137394591 TAAAGGGTATAGCCTGTGGGAGG - Intronic
998887000 5:146705428-146705450 TAATGGGTAATGAATCTGGGTGG + Intronic
1010159499 6:72835773-72835795 TAATGGTTAAAGAGCTTGGGAGG - Intronic
1013956207 6:115844140-115844162 TAATTGGTTTTGAAGGTGGGTGG - Intergenic
1015137374 6:129888651-129888673 TCATTGTTATAAAACGTGGGAGG + Intergenic
1018326660 6:162677417-162677439 TAATGGATATAGAGGGTGGGAGG - Intronic
1020990670 7:15192264-15192286 TTATGGGTACAGGATGTGGGGGG - Intergenic
1023396479 7:39756536-39756558 TAATAGATATAGAAAGTAGGAGG + Intergenic
1024779956 7:52836370-52836392 TAATGGGTATAGAGGATGGGTGG + Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1033999690 7:147397922-147397944 TAATGGGTTTAGAAAATGCGTGG - Intronic
1034909030 7:154977171-154977193 TAAAGGGTGTAGAATGTGGAAGG + Intronic
1042132615 8:65602710-65602732 TAATGGCTATAGAAAGAAGGTGG + Exonic
1042236569 8:66619201-66619223 TAATGGGTACAGATTTTGGGGGG - Intergenic
1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG + Intergenic
1048640887 8:136359732-136359754 TAATTGATATAGCAAGTGGGAGG - Intergenic
1058316547 9:103574025-103574047 TAATGGGTTTAATACCTGGGTGG + Intergenic
1186799405 X:13078324-13078346 GAGTGGGGATAGAGCGTGGGAGG + Intergenic
1188088434 X:25931900-25931922 TTATGGGTATAGAACTGGAGAGG - Intergenic
1192039278 X:67600504-67600526 TAATGGATATAGAAAGTAGAAGG + Intronic
1194924067 X:99803589-99803611 TAATGTTTATAGAACCTTGGGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic