ID: 1097640471

View in Genome Browser
Species Human (GRCh38)
Location 12:62174655-62174677
Sequence CCCAAGACAGCATTATTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097640471 Original CRISPR CCCAAGACAGCATTATTTTG AGG (reversed) Intronic
903605725 1:24573812-24573834 CCTAGTAAAGCATTATTTTGGGG + Intronic
904023201 1:27484160-27484182 CCCATGACAGCATGGATTTGTGG - Intronic
904460096 1:30671491-30671513 CCCAAGAGAGATTTATTTTAAGG - Intergenic
905752209 1:40476050-40476072 CCCAAGAAAATATTATTTTGCGG + Intergenic
906107921 1:43305771-43305793 CCCAAGACAGCCTCATGCTGAGG + Intronic
909151647 1:72013209-72013231 CCAGAGGCAGCATTATTTTGTGG + Intronic
911122994 1:94314393-94314415 CCCAAGACTCCATGATTCTGGGG + Intergenic
912142029 1:106742251-106742273 ACGAAGACAGCAAAATTTTGTGG - Intergenic
914321620 1:146568315-146568337 CCCAATACAGACATATTTTGTGG - Intergenic
915968175 1:160330503-160330525 ACAAAGACAGCATTATCTAGAGG + Intronic
920445684 1:206014438-206014460 CCTAAGACAGATTCATTTTGAGG + Intronic
920579895 1:207096652-207096674 CCCTTGGCAGCATTGTTTTGGGG + Intronic
923955766 1:239018397-239018419 CCCAGGTCTGCATTAATTTGAGG - Intergenic
924537950 1:244953756-244953778 ACCAACACAGGATTTTTTTGAGG + Intergenic
1063095532 10:2905380-2905402 CCCAAGACAGAACTAATATGTGG + Intergenic
1065809597 10:29429109-29429131 GCTAAGACAGCATACTTTTGAGG + Intergenic
1066246561 10:33589201-33589223 TCAAAGACAGGTTTATTTTGGGG + Intergenic
1070050903 10:72888676-72888698 TCAAAGACAGGTTTATTTTGGGG - Intergenic
1070056674 10:72941785-72941807 TCCCAGACAGCACTATTTTAAGG + Intronic
1071177544 10:82943733-82943755 CCTAATAAAGCATTATTTTGGGG - Intronic
1072748801 10:97961349-97961371 CCCAGGACATCATTACTTAGGGG + Intronic
1074626503 10:115194301-115194323 CCCAAGATATTATTGTTTTGGGG + Intronic
1077947635 11:6919083-6919105 CCCATAACAGCATTAATTTTAGG - Intergenic
1078715043 11:13831914-13831936 CCCAAGACAGCTGTACTATGAGG - Intergenic
1079352526 11:19703870-19703892 ACCAGGACAGCCTTAGTTTGTGG + Intronic
1079493983 11:21020244-21020266 ACCAACACAACATTATTGTGTGG + Intronic
1079778778 11:24571007-24571029 CCTAAGACAGCAATACTATGTGG + Intronic
1080884614 11:36355189-36355211 TCCAAGACAGCAATGTTTTACGG + Intronic
1082678427 11:56138738-56138760 CCCAGGAAAGCATAATGTTGAGG - Intergenic
1085249280 11:75131531-75131553 GCCAAGACAGCATTGGTCTGTGG + Intronic
1085535637 11:77215614-77215636 CCCAAGGCAGCATTGTTCTTGGG - Intergenic
1087003904 11:93450072-93450094 CCAAAAACAGCCTTCTTTTGTGG + Intergenic
1088125756 11:106421554-106421576 CACAAGACACCATGGTTTTGAGG + Intergenic
1088602505 11:111493774-111493796 CACATAGCAGCATTATTTTGTGG - Intronic
1089654215 11:119935300-119935322 CCAAAGCCAGCATGATTTTAGGG + Intergenic
1090637630 11:128700869-128700891 CCCAAGTTATTATTATTTTGAGG - Intronic
1095854547 12:46845517-46845539 ACCAAGACAGCATGATCTTGCGG + Intergenic
1097640471 12:62174655-62174677 CCCAAGACAGCATTATTTTGAGG - Intronic
1098042449 12:66365869-66365891 CACAAGATAGCATTTTTTTCTGG - Intronic
1099580231 12:84436630-84436652 CCTGAGAAAGCATTATTTTTTGG - Intergenic
1105846593 13:24299198-24299220 CCAAAGACGGCACTATTTAGTGG + Intronic
1106130536 13:26935889-26935911 CAGAAGACAGAATTATTTTTGGG + Intergenic
1109008843 13:56913159-56913181 CCCAAGAGACCACTGTTTTGGGG + Intergenic
1109700343 13:66016709-66016731 CCCAAATCAGCTTTATTTTAAGG + Intergenic
1110639846 13:77810247-77810269 AACAAAACAGCATCATTTTGGGG - Intergenic
1111438592 13:88246321-88246343 CCCAATACAGTATTAATTAGTGG - Intergenic
1112963697 13:105160655-105160677 CCTAAGACAGAATTATTTGTGGG + Intergenic
1114380921 14:22202637-22202659 CCTAAGAAAGCATAGTTTTGTGG + Intergenic
1115341170 14:32294497-32294519 CCCATGTCTGCATTATTTTTTGG + Intergenic
1116748459 14:48851098-48851120 TCCAAGACATCATTCTTTTCTGG - Intergenic
1118014814 14:61649278-61649300 TCTAATACTGCATTATTTTGTGG - Intronic
1119217224 14:72878222-72878244 CCCAACACAGAATTATTTGGAGG + Intronic
1120743241 14:88130736-88130758 ACCAAGACAGCAGTAATTTCAGG - Intergenic
1121969095 14:98340122-98340144 GCCAATAAAGCATTATGTTGGGG + Intergenic
1123961565 15:25407706-25407728 CCCAGGACAGATTTATTTTAAGG - Intronic
1124681858 15:31738729-31738751 CCCAAGAAACAATCATTTTGGGG - Intronic
1125876888 15:43156278-43156300 CCCAACAAAGGATTGTTTTGTGG - Intronic
1126176928 15:45744589-45744611 CCCAAAACACCATTACATTGGGG - Intergenic
1128234201 15:66056364-66056386 CCCCAGTCAGCATTGTTGTGAGG + Intronic
1129046321 15:72737603-72737625 CCCAAGAAAACCCTATTTTGGGG - Exonic
1129611990 15:77068130-77068152 CCCAAGAAAGTATTAGTTTGTGG - Intronic
1138065190 16:53933499-53933521 CCCATGCCAGCAATGTTTTGTGG - Intronic
1138119241 16:54385178-54385200 CACCAGACAGAATTACTTTGAGG + Intergenic
1139377797 16:66511289-66511311 CCAAATGCAGCATAATTTTGTGG + Exonic
1140012010 16:71142828-71142850 CCCAATACAGACATATTTTGTGG + Intronic
1141634235 16:85305205-85305227 GCCAGGACATCAGTATTTTGTGG - Intergenic
1145229476 17:21162550-21162572 CCCAAGACAGCAGTTCTCTGAGG - Intronic
1146450870 17:32972914-32972936 CCAAAGTCAGCACTCTTTTGGGG + Intronic
1147969014 17:44209772-44209794 CAGAAGGCAGCAGTATTTTGGGG - Intronic
1152778833 17:82217602-82217624 CCCAAGACAGGAGGACTTTGTGG - Intergenic
1153411722 18:4800709-4800731 ACAAAGACAGTATTATTTTTGGG - Intergenic
1153997733 18:10455808-10455830 ACCAAGACAGAATTTCTTTGGGG + Intronic
1154077349 18:11216599-11216621 TCCAACACAGCATGAATTTGAGG + Intergenic
1155614881 18:27710530-27710552 TCCAAGACATCATATTTTTGAGG + Intergenic
1156162480 18:34375920-34375942 CAAAAGAAATCATTATTTTGAGG - Intergenic
1157050560 18:44158949-44158971 TCTAAGGAAGCATTATTTTGAGG + Intergenic
1164871587 19:31649795-31649817 CTCAAGATAGCTTTAATTTGGGG - Intergenic
1165008160 19:32823366-32823388 CCCCACACAGCTTTTTTTTGGGG + Intronic
1166498386 19:43323070-43323092 ACAAATACAGCATTATTTTCAGG - Intergenic
1168381401 19:55926752-55926774 CCCAGTAAAGCATTTTTTTGGGG - Intronic
1168584956 19:57584424-57584446 CCCAAGAAGGCACTAATTTGGGG - Intronic
926411779 2:12611269-12611291 GCCAAAACAGCTTTATTTTGAGG - Intergenic
927655980 2:24946810-24946832 CCCAAGACAGAAGTACTTGGAGG - Exonic
931399890 2:61921741-61921763 CCCAACCCAGTATTATTTTGGGG + Intronic
939017238 2:136916966-136916988 TTAAAGACAGCATTATTATGAGG + Intronic
939850125 2:147294320-147294342 CACAACACAGCTTTATTTGGTGG + Intergenic
940514632 2:154666603-154666625 TCCAAGGCAGCATTATTAAGAGG + Intergenic
941169574 2:162120250-162120272 CCCAAGACAGCAACATATTCTGG + Intergenic
943370854 2:187014039-187014061 CCCAATACAGCAGTATTAAGAGG + Intergenic
943587092 2:189753914-189753936 ACCAGTACTGCATTATTTTGAGG + Exonic
946976869 2:225163006-225163028 GCCATGACAGCATTCTTGTGAGG + Intergenic
1169408641 20:5348263-5348285 CCCAAGGTAGCATAATTTTTGGG + Intergenic
1173126276 20:40339047-40339069 CCCATGAAATCAGTATTTTGGGG - Intergenic
1173745951 20:45437175-45437197 CCCAAGCCTACATTATCTTGTGG - Intergenic
1175255046 20:57638094-57638116 CCCAGTAAAGCATTATTTTGGGG + Intergenic
1178726563 21:35057624-35057646 CTCAGGACTCCATTATTTTGTGG - Intronic
1178803665 21:35820262-35820284 TCCAATTAAGCATTATTTTGGGG + Intronic
1179153994 21:38833694-38833716 CCAAAGACAGTGTCATTTTGAGG + Intergenic
1182823964 22:33246148-33246170 CCCTAAAAAGCATTATTTGGTGG - Intronic
950670528 3:14522774-14522796 CCTGAGACAGCAGTATGTTGGGG + Intronic
950972697 3:17204450-17204472 CCCAGGCCAGAAATATTTTGTGG - Intronic
951222824 3:20086613-20086635 CCCAATACAGCATTTTTGTGGGG - Intronic
954506023 3:51074469-51074491 CTCAAGACAACAGTATTTGGAGG - Intronic
954834480 3:53453709-53453731 CCCAACACAGCATTTTTCTTGGG - Intergenic
954908739 3:54085541-54085563 CCCAAGATGGCAGTATTTCGGGG + Intergenic
956000248 3:64722215-64722237 CCCAAGCCATGAATATTTTGAGG - Intergenic
958583657 3:96058767-96058789 CCCATGACATCATCATTTTGGGG + Intergenic
959237096 3:103738361-103738383 CAAAAGACAGCAGTATTTTTGGG - Intergenic
959786779 3:110308786-110308808 CCCAATACAGCCATATTCTGAGG + Intergenic
961105913 3:124241158-124241180 CCCAGGACAGTGTTATTTTTGGG - Intronic
962857772 3:139364519-139364541 CCCCAGTCACCATCATTTTGGGG - Intronic
963164758 3:142189859-142189881 AGCAAGACAGCATTATGTTAAGG + Intronic
963719693 3:148847742-148847764 TCCAAGATAAGATTATTTTGTGG - Intronic
963945867 3:151145062-151145084 GCCTATACAGAATTATTTTGAGG - Intronic
964913311 3:161809006-161809028 CTCAAAACAGCCTTATGTTGTGG + Intergenic
965008025 3:163051123-163051145 CCCAAAACAGCATTTTTATGAGG - Intergenic
965423042 3:168486367-168486389 ACCAAGACAACATTAAATTGAGG - Intergenic
966322400 3:178715631-178715653 CCCATGACAGCAGTATGGTGTGG - Intronic
967311995 3:188115195-188115217 CTCAAAACAGCTTTATGTTGAGG + Intergenic
970169551 4:13276047-13276069 ACCAAGACAGAAGCATTTTGTGG - Intergenic
970186553 4:13460572-13460594 CTCCAGACACCATCATTTTGGGG + Intronic
971899246 4:32637044-32637066 TCCCTGAAAGCATTATTTTGAGG + Intergenic
972809030 4:42562450-42562472 GCTAAGAAAGCATTGTTTTGGGG + Intronic
973971898 4:56221391-56221413 CATAAAACAGCAGTATTTTGAGG + Intronic
977999194 4:103535875-103535897 CCAAGGACAGGATTATTTTCAGG + Intergenic
980841699 4:138269123-138269145 CCTAAAACTGCATTATTTTCTGG + Intergenic
983777588 4:171627483-171627505 CCCAAGCTATCATTATTGTGGGG + Intergenic
987921742 5:24292236-24292258 CCCAACACATGATAATTTTGAGG + Intergenic
988042264 5:25904886-25904908 CCCAAAATAGAATTATCTTGAGG + Intergenic
990831728 5:59966526-59966548 CCATAGACAACTTTATTTTGTGG + Intronic
991335060 5:65537666-65537688 ACTAAGACAGCAGTTTTTTGTGG + Intronic
994181221 5:96768474-96768496 CCCAAAACAGTATTATTTTGTGG + Intronic
995756949 5:115515844-115515866 TCGAAGAGAGCAATATTTTGGGG - Intergenic
998040597 5:138948771-138948793 CCCAAGGCAGCAGTATTGAGAGG + Intronic
998345597 5:141459561-141459583 CCCAAAACAGAATTGTTTTGGGG + Intronic
998465428 5:142340067-142340089 CACAAGACAGCTTTAGATTGAGG - Intergenic
1001109653 5:168885190-168885212 CCCAAGTCAGCCTTGTTTTGTGG - Intronic
1001935987 5:175706426-175706448 TCCAAAATAGCATTATTTTTAGG + Intergenic
1005798729 6:29396347-29396369 CCCAAGTCAGCATTAATAGGGGG - Intronic
1011660015 6:89586665-89586687 CCCAAGACAGTCTTGCTTTGTGG - Intronic
1013928407 6:115501370-115501392 CCCAAGACTGCATAATTTATAGG + Intergenic
1014847501 6:126296646-126296668 CCCAGGCCAGCTTTGTTTTGTGG - Intergenic
1016889366 6:148990551-148990573 CCCACGAAAGCTTTACTTTGGGG + Intronic
1019011054 6:168843864-168843886 CCCAGGACAGCAGAATTATGGGG + Intergenic
1028816717 7:95155851-95155873 GACAATAAAGCATTATTTTGGGG + Intronic
1030134325 7:106232114-106232136 CCCAAGGCAGCATTATTGGTTGG + Intergenic
1032057195 7:128693177-128693199 CCAAAGAAAACATTGTTTTGTGG + Intergenic
1034493692 7:151407956-151407978 CCCAAGACAGTCTTATGTTTGGG + Intronic
1034738208 7:153448776-153448798 CCCAAGACAGCAGTATGTACAGG + Intergenic
1035824536 8:2630233-2630255 CACATGCCAGCATTCTTTTGGGG - Intergenic
1037751022 8:21682543-21682565 CCCAACTGAGCATCATTTTGGGG - Intergenic
1042060303 8:64809563-64809585 CACAAGGCAGTATCATTTTGTGG + Intergenic
1044852732 8:96444947-96444969 CCACAGACAGCATTGTTTTAGGG + Intergenic
1047038381 8:120965059-120965081 CCCGGTAAAGCATTATTTTGGGG - Intergenic
1052240086 9:26261418-26261440 TCAAAGACAGGTTTATTTTGGGG + Intergenic
1054701746 9:68419719-68419741 GCCAAGACAGAATAATTTTGTGG + Intronic
1054898826 9:70345581-70345603 CCCAAGACAGAAGTATATTTGGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057383426 9:94588616-94588638 CTCTAGATAGAATTATTTTGAGG - Intronic
1057484944 9:95475559-95475581 CCCAAGACAGTATTAAGCTGAGG - Intronic
1057619768 9:96624568-96624590 GCCAAGACAGCATGAACTTGTGG - Intergenic
1058030264 9:100188353-100188375 CTCAACACATTATTATTTTGAGG - Intronic
1059535031 9:115072681-115072703 CCAAAGTCAGCATTGTTATGTGG - Intronic
1060874794 9:127074991-127075013 CCCAAGACTGCACTGCTTTGTGG - Intronic
1062434777 9:136542064-136542086 CCCATGACACCAGTGTTTTGCGG + Intronic
1187629072 X:21148202-21148224 CCCTAGAGATTATTATTTTGAGG + Intergenic
1187837254 X:23445438-23445460 CCCAATACAGCCTTTTTTTGTGG - Intergenic
1188713487 X:33431239-33431261 CCTAAGACAATATTATTTTTTGG + Intergenic
1189847339 X:45149540-45149562 CCCAGAAAAGCCTTATTTTGTGG - Exonic
1192263689 X:69524390-69524412 CCCAAGACAGGAGTATTTTTTGG + Intronic
1192266991 X:69545583-69545605 CCCTAGATAGCCTTATATTGAGG - Intergenic
1194217254 X:91146354-91146376 CCCAAAACAGCACAATTTTATGG - Intergenic
1194773601 X:97935171-97935193 CCAAAGAAAGCATTCTCTTGGGG + Intergenic
1194987193 X:100503605-100503627 GCCAAGACAGCTATAATTTGCGG + Intergenic
1197675625 X:129326850-129326872 CCCGAGAGAGCAATTTTTTGTGG - Intergenic
1200553768 Y:4610146-4610168 CCCAAAACAGCACAATTTTATGG - Intergenic
1200970168 Y:9144018-9144040 CACAAGTCTGCAATATTTTGTGG + Intergenic
1201628507 Y:16042159-16042181 CACAAGACAGCATTATCTGCAGG + Intergenic
1202140841 Y:21720300-21720322 CACAAGTCTGCAATATTTTGTGG - Intergenic
1202146024 Y:21783498-21783520 CACAAGTCTGCAATATTTTGTGG + Intergenic