ID: 1097641893

View in Genome Browser
Species Human (GRCh38)
Location 12:62192104-62192126
Sequence GGTCCCCGCTGGTGCCCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097641883_1097641893 16 Left 1097641883 12:62192065-62192087 CCTCCGTCCAGGTGCCCCTGTTC 0: 1
1: 0
2: 0
3: 21
4: 133
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641887_1097641893 1 Left 1097641887 12:62192080-62192102 CCCTGTTCCCACTGCTCGCAGAT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641881_1097641893 24 Left 1097641881 12:62192057-62192079 CCCGCGTTCCTCCGTCCAGGTGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641890_1097641893 -6 Left 1097641890 12:62192087-62192109 CCCACTGCTCGCAGATAGGTCCC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641888_1097641893 0 Left 1097641888 12:62192081-62192103 CCTGTTCCCACTGCTCGCAGATA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641884_1097641893 13 Left 1097641884 12:62192068-62192090 CCGTCCAGGTGCCCCTGTTCCCA 0: 1
1: 0
2: 5
3: 42
4: 381
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641885_1097641893 9 Left 1097641885 12:62192072-62192094 CCAGGTGCCCCTGTTCCCACTGC 0: 1
1: 0
2: 0
3: 26
4: 393
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641891_1097641893 -7 Left 1097641891 12:62192088-62192110 CCACTGCTCGCAGATAGGTCCCC 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641882_1097641893 23 Left 1097641882 12:62192058-62192080 CCGCGTTCCTCCGTCCAGGTGCC 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114
1097641886_1097641893 2 Left 1097641886 12:62192079-62192101 CCCCTGTTCCCACTGCTCGCAGA 0: 1
1: 0
2: 1
3: 9
4: 174
Right 1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG 0: 1
1: 0
2: 1
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097641893 Original CRISPR GGTCCCCGCTGGTGCCCTCG CGG Exonic
900100860 1:961368-961390 GGGCCACGCTGTGGCCCTCGCGG - Exonic
900353335 1:2247761-2247783 GGGCCCCACAGGTGCCCTTGGGG + Intronic
900706544 1:4083909-4083931 GGTGCCTGCTGATGCCCTGGTGG + Intergenic
901459525 1:9383275-9383297 GGTCCCCGCAGGTCCCCCCTGGG - Intergenic
920201347 1:204261627-204261649 GGTACCAGCTGGAACCCTCGGGG - Intronic
1062835357 10:632320-632342 AGTTCACGCTGGTGCCCGCGTGG - Intronic
1062874446 10:932519-932541 GGTCCCCGGTGGGGCCTTCGGGG - Intergenic
1064859773 10:19815553-19815575 GGTCCCCGCCGCTGCCGCCGCGG - Intergenic
1065325234 10:24544974-24544996 GGGCCCCGCTGGAGCCCTGTGGG - Exonic
1067066047 10:43104905-43104927 GGTCCCGGCTGGTGATCACGCGG + Intronic
1070302047 10:75210765-75210787 GGACCCCGCCGCTGCCCCCGGGG - Intronic
1070565809 10:77603172-77603194 CATCCCCCCTGGTGCCCTCAGGG + Intronic
1070733098 10:78845168-78845190 GGTCCCTGGCGGTGCCCTGGTGG - Intergenic
1079008462 11:16809469-16809491 GGTCCCCCCTGGTTCCTTGGAGG - Intronic
1079401730 11:20111359-20111381 TGTCTCTGCTGCTGCCCTCGGGG + Intronic
1081870990 11:46382385-46382407 GGGCCCCGCAGGTGCCCTCGCGG - Exonic
1083663287 11:64261982-64262004 AGTCCACGCGGGTGCCCTTGGGG - Exonic
1083782611 11:64925968-64925990 TGGCCCTGCTGGTCCCCTCGGGG - Intronic
1083916461 11:65747547-65747569 GGTCCTCGGTGGTGCACTCATGG - Intergenic
1084515751 11:69637287-69637309 GATCCGCGCTGAGGCCCTCGTGG - Intergenic
1084552997 11:69859772-69859794 GGTTCCCGCTGGTGGGTTCGTGG - Intergenic
1084592524 11:70098798-70098820 GGTCCCCGCTACAGCCCCCGTGG - Intronic
1089141122 11:116285182-116285204 GGACCATGCTGGTGCCCTCTTGG - Intergenic
1090399598 11:126440591-126440613 CGTCCCTGCTGGCGCCCTCTTGG + Intronic
1097641893 12:62192104-62192126 GGTCCCCGCTGGTGCCCTCGCGG + Exonic
1102961973 12:117099058-117099080 GGTCCCCGCTGGCCACCTCGCGG - Intronic
1117910918 14:60637684-60637706 GGCCTCCGCTGAGGCCCTCGGGG + Intergenic
1119319191 14:73719266-73719288 TGTCCCCGCTGGGACCCCCGCGG - Exonic
1119742957 14:77026221-77026243 GGTCCCCGGGGGTGCGCTGGGGG + Exonic
1121318197 14:92974657-92974679 GGCCCTCTCAGGTGCCCTCGTGG + Intronic
1122695200 14:103549038-103549060 GGTGCCCGCTGGGGTCCACGTGG + Intergenic
1123945924 15:25238888-25238910 GGTGCCCGGTGGTGCCCACATGG + Intergenic
1124121683 15:26893828-26893850 GGTCCATGCTGCTGCCCACGCGG - Intronic
1127847800 15:62886649-62886671 GGTCTCTGCTTTTGCCCTCGCGG - Intergenic
1132617984 16:851813-851835 GGACCCAGCTGGGGGCCTCGAGG - Intergenic
1132629166 16:908553-908575 GGGGCCTGCTCGTGCCCTCGAGG + Intronic
1132959221 16:2612858-2612880 GGTGCCTGCGGGTGCCCTGGAGG - Intergenic
1132972281 16:2694833-2694855 GGTGCCTGCGGGTGCCCTGGAGG - Intronic
1139675956 16:68523660-68523682 GGTTCCCGCTGGTGGGTTCGTGG + Intergenic
1139947985 16:70654676-70654698 GGACACAGCTGGTGCCCACGTGG - Intronic
1144870753 17:18369169-18369191 TGACCCCGGTTGTGCCCTCGGGG + Intergenic
1147188304 17:38724799-38724821 GCTGCCCGCTGGAGCCCTAGTGG + Exonic
1147315710 17:39619125-39619147 GGTGCCAGCTGGTGCCCATGGGG - Intergenic
1151257036 17:72885928-72885950 GGTCACCACTGGTGCCCATGTGG + Intronic
1152096918 17:78277949-78277971 GGTCCCGGCCGGTGCTCACGGGG + Intergenic
1152987704 18:334982-335004 GGTCCCCACTGGAGCCCTGAGGG + Exonic
1155199429 18:23503894-23503916 TGTCCTCGCAGGTGACCTCGGGG + Intronic
1155928789 18:31685023-31685045 GGGGCCCGCGGGGGCCCTCGGGG + Intronic
1158718343 18:59900218-59900240 GGTACCTGCTGGAGCCCGCGCGG - Exonic
1160174014 18:76578735-76578757 GGTTCCACCTGGTGCCCTGGCGG + Intergenic
1160981996 19:1820433-1820455 GTTCCCCGCTGGAGGCCTTGTGG - Intronic
1161257001 19:3315118-3315140 CGGCCACCCTGGTGCCCTCGTGG - Intergenic
1161318794 19:3631640-3631662 TGTCCTCGCTGGGGACCTCGGGG + Exonic
1162738121 19:12757876-12757898 GGTCCCCGCAGCTGCACTCCGGG - Exonic
1165138342 19:33684809-33684831 AGTCCCCGCTGCTGCCACCGCGG + Exonic
1165855706 19:38878414-38878436 GGTCCTCACGGGGGCCCTCGTGG - Intergenic
1166059924 19:40319906-40319928 GGTCCCCGCTGGGGCTCAGGCGG - Exonic
1167293265 19:48635854-48635876 GGTCCCCGCGGGGGCGCCCGGGG - Exonic
1167495114 19:49813043-49813065 GGACCCCGCTGGAGGCCGCGAGG + Exonic
1168350778 19:55674548-55674570 GGTCCTCTCTGGTCCCCTCCTGG + Intronic
926089692 2:10042316-10042338 GGTCCCCACTTGTTCCTTCGGGG - Intergenic
929598952 2:43193109-43193131 GGTCCCAGCTGGAGACCTGGTGG + Intergenic
933811102 2:86033248-86033270 GGTCCCTGCCAGTGCCCTGGTGG + Intronic
935802662 2:106714323-106714345 GGTCCCAGATGTTGCCCTCTGGG - Intergenic
948193116 2:236075447-236075469 GGTCCCCGCTGCTGCCCCCTTGG + Intronic
948204567 2:236156432-236156454 CCTCCCCGCAGGTGCCCTCTGGG - Intergenic
1168819024 20:761227-761249 CGGCCCCGCAGGTGGCCTCGTGG - Exonic
1169911373 20:10650307-10650329 GGTCCTGGCAGGTGCCCCCGTGG + Exonic
1169914850 20:10674290-10674312 GGTCCCCGCTGGGGGCCTCCAGG - Intergenic
1170588371 20:17752619-17752641 GGTCACTGCTGGTGCCCTAATGG + Intergenic
1171935938 20:31274751-31274773 CGTCCTCGCGGGTCCCCTCGTGG - Intergenic
1172292866 20:33788779-33788801 GGTCCCCGCTGGGCCCCTCAGGG - Intronic
1175924024 20:62463219-62463241 CGTCCCCCCAGGTGCCCTCAAGG - Intergenic
1176194415 20:63830853-63830875 GGCCCCCGCGGGTGCCCCCCAGG - Intronic
1180042874 21:45288756-45288778 GGCCAGTGCTGGTGCCCTCGGGG - Intergenic
1180045082 21:45301532-45301554 GGCCCCTGCAGGTGACCTCGAGG - Intergenic
1180080301 21:45483596-45483618 CGCCCCCGGAGGTGCCCTCGAGG + Intronic
1180934384 22:19615066-19615088 GGTCCCCTGTGGTGCTCTGGTGG - Intergenic
1185043656 22:48518191-48518213 GGTACCCGCAGGAGCCCACGTGG + Intronic
954909063 3:54087909-54087931 AGAGCCGGCTGGTGCCCTCGGGG - Intergenic
961322361 3:126084366-126084388 GGGCCCCACTGGCGCCCCCGCGG + Intronic
961336043 3:126180344-126180366 GGGCCCCGCAGGAGCCCTTGCGG + Intronic
966619431 3:181947588-181947610 GGTCCCAGCTGGGGCCCTCAAGG - Intergenic
966899429 3:184469632-184469654 GCTCCCCGCTGTTACCCTCAGGG + Intronic
967166561 3:186784456-186784478 GGACCCCGATGGTGTCATCGAGG + Exonic
969213917 4:5708386-5708408 CGTCCCCGCTGGCGCCCCCTCGG - Exonic
969610926 4:8227461-8227483 GGTCCCCGAAGCTGCCCTCCAGG - Exonic
971689781 4:29818151-29818173 AGTCCCAGCAGGTGCCATCGTGG - Intergenic
981429616 4:144645214-144645236 GGGCCCCGCTGGTACCATCTGGG - Intergenic
985716775 5:1467398-1467420 GCTCCCCGCTGGAGCCCTCCCGG - Intronic
986304937 5:6507941-6507963 GGTCCCTGCAGGTGACCTTGGGG + Intergenic
998458818 5:142294430-142294452 GCTCCCAGCTGATTCCCTCGGGG + Intergenic
1004829558 6:19462648-19462670 GGACACAGGTGGTGCCCTCGGGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006629073 6:35418490-35418512 TGACCACGCTGGTGCCCTGGTGG + Intronic
1006729779 6:36228357-36228379 GGGCCCAGCTGCTGCCCTTGTGG + Intronic
1013836667 6:114342663-114342685 GGGCTGCGCCGGTGCCCTCGTGG - Exonic
1018941188 6:168309646-168309668 GGTCCCTGCAGATGCCCTGGAGG + Intronic
1018966108 6:168490427-168490449 GGTCCCCTCTGGAGCCCACCTGG - Intronic
1019411407 7:908366-908388 GGGGACAGCTGGTGCCCTCGGGG + Intronic
1019501499 7:1367047-1367069 GCTGCCTGCGGGTGCCCTCGGGG + Intergenic
1022518274 7:30989162-30989184 GGGCCCAGTTGGAGCCCTCGTGG + Intronic
1035411564 7:158647433-158647455 GGTCCAGGCAGGTGCCCTCGTGG - Intronic
1036791945 8:11726798-11726820 GGGCCCTGATGGTGCCCTCCTGG + Intronic
1038266035 8:26040660-26040682 GGTCCCCGCAGGTGTCCGCACGG - Exonic
1039574222 8:38610811-38610833 GGTCTCCGCTGGAACCCTGGGGG + Intergenic
1042316789 8:67434639-67434661 GCTGCCCGCTGGAGCCCTAGTGG + Intronic
1049738179 8:144221187-144221209 GGACCCGGTTGGCGCCCTCGTGG + Intronic
1049777598 8:144413752-144413774 GGTCTGCGCGGGAGCCCTCGTGG + Exonic
1049778201 8:144415944-144415966 CGTCCTCACAGGTGCCCTCGGGG + Exonic
1051894704 9:21975103-21975125 GCTTCCGGCTGGTGCCCCCGGGG - Intronic
1052877826 9:33580581-33580603 AGTCCCCGCAGCTGCCCTCATGG - Intergenic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1053498157 9:38563624-38563646 AGTCCCCGCAGCTGCCCTCATGG + Intronic
1057161341 9:92890502-92890524 AGTCCCCACTGCTGCCCTCATGG + Intergenic
1057481249 9:95447228-95447250 AGGGCCCGCTGGGGCCCTCGCGG - Exonic
1057677630 9:97148120-97148142 AGTCCCCGCAGCTGCCCTCATGG + Intergenic
1057828486 9:98389355-98389377 GGTACCCGTGGGTGCCTTCGGGG + Intronic
1060823587 9:126674815-126674837 GGTCCAGGCTGGTGCCCTGCAGG - Intronic
1061478385 9:130884291-130884313 GGTCCCCAATGGAGCCCTCCGGG + Exonic
1061638954 9:131936357-131936379 GGTCCTCACTGTGGCCCTCGAGG - Intronic
1062428151 9:136515525-136515547 GGTCCTGGCAGGTGCCCCCGTGG + Exonic
1196866669 X:120077067-120077089 CGCTGCCGCTGGTGCCCTCGAGG + Exonic
1196876430 X:120159214-120159236 CGCTGCCGCTGGTGCCCTCGAGG - Exonic
1201263858 Y:12187167-12187189 GGTTCCTGCTGGTGGGCTCGTGG - Intergenic