ID: 1097643787

View in Genome Browser
Species Human (GRCh38)
Location 12:62212127-62212149
Sequence ACAGCAAATCAGGGAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097643784_1097643787 -4 Left 1097643784 12:62212108-62212130 CCTTTGTGATTCAAGATATACAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG 0: 1
1: 0
2: 3
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097643787 Original CRISPR ACAGCAAATCAGGGAAAAGC AGG Intronic
900335614 1:2161527-2161549 ACACCACATCAGGAAACAGCAGG - Intronic
901244092 1:7715068-7715090 ATAGCAGATCAGGCAAAATCAGG - Intronic
901674203 1:10873390-10873412 ACACCCAATCAGGGAGAAGAAGG - Intergenic
901674209 1:10873419-10873441 ACACCCAATCAGGGAGAAGAAGG - Intergenic
901938037 1:12641004-12641026 ACAGCATTTCAGGGAAAAGTGGG - Intergenic
902212010 1:14911225-14911247 ACAGCAAATCAGTACAGAGCTGG - Intronic
903554282 1:24181721-24181743 CCAGCAACCCAGGGAAAACCAGG - Intronic
904827346 1:33282047-33282069 CCAGAGAAACAGGGAAAAGCGGG - Intronic
905271393 1:36790018-36790040 ACAGGATATAAGGGAAAAGATGG - Intergenic
905334176 1:37232668-37232690 AGAGAAGAACAGGGAAAAGCTGG + Intergenic
905903421 1:41597362-41597384 ACAGACAATCAGGGGAAATCTGG - Intronic
906617579 1:47244537-47244559 ACAGCATATCAGAGAAACTCAGG + Intergenic
907383837 1:54112760-54112782 ACACCACTTCAGGGCAAAGCTGG + Intergenic
910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG + Intergenic
910165791 1:84326077-84326099 ACAGAAAAGAAAGGAAAAGCAGG + Intronic
911281436 1:95934322-95934344 ACAGAACACCAGGGAAAAGGGGG + Intergenic
912164831 1:107030739-107030761 ACACCAAGGCAGGGAAAAGATGG - Intergenic
914910647 1:151783056-151783078 CAAGCAAAGCAGGGAAAAGAGGG + Intronic
915746879 1:158168027-158168049 ACAGCTAATCAGGAGTAAGCAGG + Intergenic
915911098 1:159916075-159916097 AAAGCAATTAAGGGAGAAGCAGG - Intergenic
916401560 1:164454197-164454219 ACAGAAACTCAGAGAAAAGTAGG + Intergenic
916492247 1:165312304-165312326 ACAGCAAATAGGGGCAGAGCTGG - Intronic
916808026 1:168279115-168279137 ACAGCAATTCAGGCAAGAGCTGG - Intergenic
916816647 1:168360383-168360405 ACACCAAGTCAAGGAGAAGCTGG + Intergenic
917501599 1:175590768-175590790 AAAGCAAAGCAGGTAATAGCAGG + Intronic
918146926 1:181765212-181765234 ACACAAAATAAGGGAAAAGAGGG - Intronic
920309916 1:205043031-205043053 ACAGCAAATGAGGTAAAGCCAGG + Intergenic
920793933 1:209120102-209120124 AGAGCAAAGCAGGGCACAGCTGG - Intergenic
921555812 1:216597467-216597489 GCAGAAAAGCAGGAAAAAGCAGG + Intronic
921710135 1:218365481-218365503 TCAGCGAGTCAGGGAAAATCAGG + Intronic
922908678 1:229197328-229197350 ACAGGAAGTAAGGGAAAAGATGG - Intergenic
923373668 1:233338702-233338724 GCAGCACATGAGGGAGAAGCAGG + Intronic
923639300 1:235737855-235737877 ACAGTCAGTCAAGGAAAAGCAGG - Intronic
923850605 1:237790210-237790232 TCAGCAACTAAGGGAACAGCTGG - Intronic
1063182638 10:3619096-3619118 ACAGCAAACCAAGGAAACCCTGG + Intergenic
1063574642 10:7250846-7250868 AAAGCAAATCAGGAAACAGAAGG + Intronic
1064142090 10:12799087-12799109 CCAGCAAGTCAGGGAAACCCTGG + Intronic
1065375352 10:25034817-25034839 ACAGCATTTAAGGGAAAAGGGGG - Intronic
1065561868 10:26971803-26971825 ACACCAAGCCAGGTAAAAGCTGG - Intergenic
1068668242 10:59698336-59698358 ACAGCAAGTCAGGAAGGAGCAGG - Intronic
1069259120 10:66371884-66371906 AAAGCAAGTGAGGCAAAAGCAGG + Intronic
1070767244 10:79063854-79063876 ACAGCAAGTCAGGCAATGGCGGG + Intergenic
1070844445 10:79510385-79510407 ACAGGAAATGATGGAAAAGCAGG - Intergenic
1070929352 10:80249923-80249945 ACAGGAAATGATGGAAAAGCAGG + Intergenic
1072521991 10:96237183-96237205 ACAGAAAACCAGGTAAATGCTGG + Intronic
1072535408 10:96359149-96359171 ACAGAAAATCAAGGCAAAGAGGG - Exonic
1072967153 10:99983535-99983557 GCAACAGATGAGGGAAAAGCAGG + Intronic
1073026467 10:100490379-100490401 AGAGCATATCAGGGAGAAACAGG + Intronic
1075500320 10:122967176-122967198 AATGCAAAACAGGAAAAAGCAGG + Intronic
1076018022 10:127044752-127044774 ACAGCACAGCATGGAAAGGCTGG - Intronic
1077265344 11:1645768-1645790 ACAGCTCACCAGTGAAAAGCAGG - Intergenic
1078758645 11:14234291-14234313 AGAGCAAAGAAGGGAAAAGGGGG - Intronic
1078894395 11:15585057-15585079 ACAGGAAGACAGGGAAACGCAGG + Intergenic
1079397960 11:20082328-20082350 TCAGCCAGACAGGGAAAAGCTGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1080276574 11:30509697-30509719 ACAGAAAATCAAGGGACAGCAGG + Intronic
1081467429 11:43334557-43334579 ACAAAAAATCAAGGTAAAGCTGG + Intronic
1081487050 11:43538800-43538822 ACAGCAATTCAGGGATCACCTGG - Intergenic
1085417251 11:76327706-76327728 ACAGCAAGTTAGTGAAGAGCTGG + Intergenic
1087367491 11:97239398-97239420 ACTGGAAATCAGGGGAAAGAAGG + Intergenic
1088360895 11:108989004-108989026 AAAAAAAATCAGTGAAAAGCAGG + Intergenic
1088678794 11:112221874-112221896 ACAGCAAGTCTGGGAAATCCTGG - Intronic
1088777716 11:113101536-113101558 AAAGCAAATGGGGGAAAAACAGG - Intronic
1089221363 11:116874730-116874752 AGGTCAAATCAGGGCAAAGCTGG - Intronic
1089442205 11:118527183-118527205 AAAGCATTTCAGGGAGAAGCTGG + Intergenic
1090129079 11:124120644-124120666 ACAGCAAATCTGGTGGAAGCTGG - Intronic
1091126952 11:133108996-133109018 AGAGCAAAACAGGTAAACGCAGG - Intronic
1091691630 12:2601336-2601358 AAAGCAAATCTGGGCAAACCAGG + Intronic
1092155258 12:6278384-6278406 AGAGCAAATCAGGAAAAAATAGG - Intergenic
1092849323 12:12612341-12612363 CCAGGAAATCAGGGAACACCGGG + Intronic
1092927531 12:13285263-13285285 AAAGAAAATCATGGAAAATCTGG + Intergenic
1094871919 12:34603554-34603576 AAAGCATATCAGGCAAAAGGGGG + Intergenic
1095254561 12:40019428-40019450 AGAGCAGAACAGGGAGAAGCTGG + Intronic
1095776323 12:46013889-46013911 ACAGGAAACCAAGAAAAAGCAGG - Intergenic
1095861247 12:46920144-46920166 ACAGCAAATCCAGGGAGAGCAGG - Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1099060840 12:77906174-77906196 AGAATAAAGCAGGGAAAAGCAGG + Intronic
1099158512 12:79209780-79209802 ACAGCAGATCAAGGAAAACTTGG + Intronic
1099967521 12:89465277-89465299 ACAGTAAATCAGAGAAAAAATGG + Intronic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1105357749 13:19674681-19674703 TTAGCAAAACAAGGAAAAGCAGG + Intergenic
1105566822 13:21557658-21557680 ACAGCAAAATAAGGAAAAACAGG - Intronic
1105910528 13:24861312-24861334 ACAGCAAAATAGGGTAAAGATGG - Exonic
1106097242 13:26659098-26659120 ACAGCAGAGCAGGGATAAGAGGG + Intronic
1106433276 13:29702855-29702877 ACAGAAAACCAAGGAAATGCCGG + Intergenic
1107008027 13:35637068-35637090 ACAACAAATGAGAGAAATGCTGG - Intronic
1107133636 13:36920785-36920807 AAAGCAAATCAGGAACAAACAGG - Intergenic
1107350744 13:39512179-39512201 ACAGGAAATCAGTGTTAAGCAGG - Intronic
1107357957 13:39588058-39588080 ACAGCCAAGCAGGGAAAGGTCGG + Intronic
1107487531 13:40843588-40843610 ACATCATAACAGGCAAAAGCTGG + Intergenic
1107881537 13:44836625-44836647 ACAGTAATTCAGGTGAAAGCAGG - Intergenic
1109249387 13:60000729-60000751 AGAGCAAATAAAGGAAAAGATGG - Intronic
1110594831 13:77308721-77308743 AAAGTAAAACAGGGAAAAGAAGG + Intronic
1111159442 13:84374528-84374550 ACAGCTAATCAAGAAAAAACAGG + Intergenic
1111239228 13:85453008-85453030 ACAACATATCAGAGAAAAACTGG - Intergenic
1112102859 13:96209402-96209424 ACAGGAAACCAGAAAAAAGCTGG - Intronic
1112609419 13:100941345-100941367 ACAGCTAATCAGGGTGCAGCAGG + Intergenic
1113493606 13:110712341-110712363 GAAGAAAATCAGAGAAAAGCAGG + Intronic
1113639167 13:111944815-111944837 AGAGCAAACTAGGGAAAGGCTGG - Intergenic
1114664013 14:24368111-24368133 GCAGCCAATCAGGGACAGGCTGG + Intronic
1115669704 14:35596426-35596448 ACAGAAAATTAGGGAAATACAGG + Intronic
1117346774 14:54840522-54840544 CCAGCTAAACAGGGAAAAGAAGG - Intergenic
1117461554 14:55950412-55950434 ACAGCCAATCAATGAAAAGAAGG - Intergenic
1118298180 14:64589730-64589752 ACAGCTACTCAGGCTAAAGCAGG - Intergenic
1118765612 14:68907615-68907637 ACAGCAAAACAGGGAGAAACTGG + Intronic
1120316114 14:82895537-82895559 ACAGCAAATGGGGTCAAAGCAGG + Intergenic
1120611491 14:86646696-86646718 ACACCAAACAAGGGAAATGCAGG + Intergenic
1121992752 14:98575437-98575459 GCAGCAAAGCAGGTAAAACCTGG - Intergenic
1122785966 14:104163405-104163427 ACAGCAGATCAGGGACAGGATGG - Intronic
1124918726 15:34002499-34002521 ACAGCTGATCACGGAAAGGCTGG + Intronic
1125601469 15:40918006-40918028 AAAACAAAACAAGGAAAAGCAGG - Intergenic
1127757577 15:62107868-62107890 GGAGGAAATGAGGGAAAAGCAGG - Intergenic
1128020663 15:64387683-64387705 ACAACAAAGCAGGAAGAAGCAGG + Intronic
1128329891 15:66748732-66748754 AAAGCAAGTTAGGGAACAGCAGG - Intronic
1128546466 15:68572005-68572027 ACAGAAGAACAGGGATAAGCAGG + Intergenic
1128629356 15:69247785-69247807 ACAGGCAATCGGGGAACAGCTGG + Intronic
1129342015 15:74892431-74892453 GGGGCAAATCAGGGAAAAGCTGG - Intronic
1129405048 15:75311429-75311451 AGAGTAAATCAGGGAACAGGAGG - Intergenic
1129514411 15:76148323-76148345 ACAGCAAACCTGGAAAGAGCTGG + Intronic
1130829383 15:87584029-87584051 TGAGCATATCAGGAAAAAGCAGG + Intergenic
1131977398 15:97960601-97960623 ACAACAAATCAGCAAGAAGCAGG + Intergenic
1137529075 16:49265458-49265480 ACAGCTGATCAGGGCAGAGCTGG + Intergenic
1137529095 16:49265628-49265650 ACAGCTGATCAGGGCAGAGCTGG - Intergenic
1139320465 16:66109869-66109891 TAAGCAAAACAGGGCAAAGCAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140507484 16:75482887-75482909 ACAGCCACTCTGGGAAAACCTGG + Intronic
1141817364 16:86421511-86421533 ACAGCAAAACAGAGAATAGTAGG + Intergenic
1142135209 16:88448797-88448819 GCAGCAAAGCAGGGAAGCGCAGG - Intergenic
1143104829 17:4524129-4524151 ACAGCAAATCAGGCAGAACTGGG - Intronic
1143638773 17:8183088-8183110 CTAGAAAAACAGGGAAAAGCAGG - Intergenic
1143699606 17:8648411-8648433 ACAGCAAGTCAAGGCAGAGCTGG + Intergenic
1144379850 17:14683893-14683915 ACAGAAAATAAGAGAAAAGAAGG + Intergenic
1144529922 17:16027450-16027472 ACAACACATCAGGGAAGAGTTGG + Exonic
1144841158 17:18186826-18186848 AAAGCAAATGAGAGAAAAGCTGG - Intronic
1145129995 17:20336267-20336289 ACAGAGAATTAGGGGAAAGCAGG + Intergenic
1149444496 17:56703295-56703317 ACAGCACATGCAGGAAAAGCTGG - Intergenic
1149566884 17:57646614-57646636 ACAGCAAAGCAGGGACAGCCAGG + Intronic
1150194710 17:63285298-63285320 ATAGCAAAATAGAGAAAAGCAGG - Intronic
1150295780 17:64006635-64006657 ACAGCAGATCAGGGTGAAGAGGG + Exonic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1151651986 17:75475795-75475817 ACAGCCATGCAGGGAAGAGCCGG - Intronic
1153092884 18:1368776-1368798 AGAGCAAAGCAGGAAAAGGCAGG - Intergenic
1153528964 18:6024334-6024356 ACAGTAAAACAGGGAAAACCAGG - Intronic
1153544725 18:6193891-6193913 AAAGCACACCAGGGAATAGCAGG + Intronic
1153585757 18:6618217-6618239 ACTGGTAATCAGGGAAAAGGTGG + Intergenic
1155079980 18:22399447-22399469 TCAGGAAATCAGGGAAATCCTGG + Intergenic
1156031058 18:32712925-32712947 GCAGCCAATCAGGTAAAAGGAGG - Intronic
1156397673 18:36714090-36714112 AAATTAAATCAGAGAAAAGCAGG + Intronic
1157016532 18:43721393-43721415 AATGGAAATCAGGAAAAAGCAGG + Intergenic
1157024745 18:43829338-43829360 AAAAGAAATCAGAGAAAAGCTGG + Intergenic
1157680153 18:49598778-49598800 AAAGCAGATCAGGGACAACCTGG - Exonic
1157931045 18:51823825-51823847 TCAGCAAATCAGGGTGAATCAGG + Intergenic
1158129991 18:54141888-54141910 ACAACAGATCAGGGTAAAGAAGG + Intergenic
1158943830 18:62431377-62431399 ATAGCAAAGCAAGGAAAAGCAGG + Intergenic
1159648745 18:70952443-70952465 AAGACAAATCAGGGAGAAGCTGG - Intergenic
1160335932 18:78039495-78039517 AAAACAAAACAAGGAAAAGCAGG - Intergenic
1160405242 18:78641096-78641118 AAAGGAAATCAGGGAAAAGGTGG - Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1161009522 19:1953612-1953634 AGAGCTGACCAGGGAAAAGCTGG - Intronic
1162249583 19:9430904-9430926 ACAGCAACTCAGGAGACAGCCGG - Intronic
925378452 2:3406052-3406074 TCTGCAAGTCAGGGAACAGCTGG - Intronic
925844632 2:8024368-8024390 TCAGGACACCAGGGAAAAGCAGG + Intergenic
925966710 2:9073350-9073372 ACAGCAAATGTGGCAAAAACAGG + Intergenic
926213927 2:10891956-10891978 ACAGCAAATGAGAGGAAAACTGG + Intergenic
927311173 2:21633332-21633354 ACAGCAATTCAGAGAAAAGCTGG + Intergenic
927843503 2:26459667-26459689 CCAGCAAATTAGGGTAGAGCCGG - Intronic
928244259 2:29613897-29613919 CCAGCAAGTCAGGAAAAAGGGGG + Intronic
929342397 2:40837058-40837080 TCAGTAAATCTGGGAAAAGTGGG - Intergenic
929699963 2:44153579-44153601 ATTAGAAATCAGGGAAAAGCCGG + Intergenic
930706011 2:54505773-54505795 ACAGCAATTCAAGGAAAACGTGG - Intronic
932296519 2:70628053-70628075 ACAGAAAAAGAGGGAAAAGAAGG + Intronic
935554204 2:104489796-104489818 AGAGGAAAACAGGGAAAAGGAGG + Intergenic
936142164 2:109949792-109949814 ACCGCAAAGCAGGGTAATGCAGG - Intergenic
936178854 2:110247751-110247773 ACCGCAAAGCAGGGTAATGCAGG - Intergenic
936202524 2:110421681-110421703 ACCGCAAAGCAGGGTAATGCAGG + Intronic
936517856 2:113193391-113193413 ACAGCAAAGCAGGGAAACTTTGG + Intronic
938248077 2:129794366-129794388 TTAGCAAATCAGGGACAACCAGG + Intergenic
938422997 2:131158754-131158776 ACAGCTAATAAGGGAATATCTGG - Intronic
940099376 2:150016538-150016560 TCAGCAGATCTGGGAATAGCAGG + Intergenic
943819524 2:192302550-192302572 ACAGAAAATGAAGGAAAAGCAGG + Intergenic
944070200 2:195658582-195658604 AAAGCAAGTAATGGAAAAGCTGG + Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946110690 2:217412707-217412729 CCAGCAGATCAGGGAAAACATGG - Intronic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
947580943 2:231317872-231317894 ACTGAAAATCAGTGAAAAACGGG - Intronic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
948312391 2:236998302-236998324 AAAGCAAATCAAAGAAAACCTGG + Intergenic
948472752 2:238195587-238195609 ACAGAATTTCAGGAAAAAGCTGG - Intronic
949054310 2:241917425-241917447 AATGGAAATCAGGAAAAAGCAGG + Intergenic
1170117579 20:12877114-12877136 AGAGTAAGTCATGGAAAAGCAGG + Intergenic
1170781042 20:19425573-19425595 ACAGCAATACTGGGACAAGCTGG - Intronic
1171234226 20:23511146-23511168 ACAGCAATCCCGGGAGAAGCTGG + Intergenic
1172122140 20:32604692-32604714 ACAGCAAATTAGGGCAGAGCAGG + Intronic
1172824653 20:37771020-37771042 ACAGCTAATAAGGGAAAGTCAGG - Intronic
1172828348 20:37809637-37809659 TCAGCAATTCAGAGAAGAGCAGG - Intronic
1172883144 20:38214564-38214586 ATAGCAAGTCAGGGAGGAGCTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174317727 20:49715367-49715389 ACAGCTAACAATGGAAAAGCTGG - Intergenic
1174379034 20:50144835-50144857 AAAGGAAATAAGGGAAAAGCCGG - Intronic
1175753334 20:61514147-61514169 ACTGCAAATCAGAGAATCGCTGG - Intronic
1175774622 20:61645254-61645276 ACAGCCATGCAGGGCAAAGCTGG - Intronic
1177629877 21:23712599-23712621 AAGCCAAATCAGGAAAAAGCTGG + Intergenic
1181572499 22:23775190-23775212 ACAGCAAGTCATGCAAGAGCTGG - Intronic
1182613708 22:31571241-31571263 ACACCAAATCATAGAAAAGGTGG + Intronic
1183523776 22:38311737-38311759 ACAGCAAATGAGGAACACGCTGG + Intronic
1184582344 22:45426154-45426176 GCAGCAAATCCAGGAGAAGCTGG + Exonic
1184933591 22:47701280-47701302 AAAGCAATTCTTGGAAAAGCAGG - Intergenic
949642248 3:6049905-6049927 ACAGCTAGTCAGGCAAAAGGAGG + Intergenic
949953280 3:9247353-9247375 ACAGGAGACCAGGGAAGAGCAGG + Intronic
950126465 3:10512864-10512886 ACAGCCCATCACGGTAAAGCAGG - Intronic
950399179 3:12757814-12757836 ACAGCCAAAAATGGAAAAGCTGG + Intronic
950561104 3:13726340-13726362 ACAGGAAATGAGGGAAAAAATGG - Intergenic
952160593 3:30689504-30689526 ACAACAAATCAGGCACAATCGGG + Intronic
952541653 3:34373458-34373480 ACTGCAAATCCGGAAAAACCAGG + Intergenic
952663978 3:35881979-35882001 ACAGGAAATCTGGGGCAAGCTGG - Intergenic
953455336 3:43036226-43036248 TCAGCAAACCAGGGAAGAGGTGG - Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
955640510 3:61078059-61078081 ACAGCAAAGCAGAAAAAGGCAGG + Intronic
957547340 3:81656568-81656590 ACAGCCAATAAGGGAAAATTTGG + Intronic
959351457 3:105269913-105269935 ACAACAAATCAGGCAAAAGAAGG + Intergenic
960261951 3:115578161-115578183 AGAGAAAAGCAGGGAAAAGCAGG + Intergenic
960742595 3:120851422-120851444 TCTTCAAATCAGGGAAAAGGAGG + Intergenic
961175653 3:124832936-124832958 ACAGCACATAAGGGAAAACAAGG + Intronic
961929224 3:130516251-130516273 ACAGAAAAGCATGGAAAAGAGGG - Intergenic
962939979 3:140117005-140117027 ACAGCAGAGCAGGGGAAAGGGGG - Intronic
965462648 3:168986736-168986758 ACATCAATTCATGAAAAAGCAGG + Intergenic
965610534 3:170538953-170538975 ACAGGAAATCAGAGAAGAGGAGG - Intronic
967085222 3:186088732-186088754 AGGGCAAATCAGGGAAAAAGAGG - Intronic
967210769 3:187166519-187166541 ACAGCAGGTGAAGGAAAAGCTGG + Intronic
967510843 3:190310070-190310092 AAAGCAAATCTGGGAAATGATGG + Intronic
970855222 4:20643672-20643694 ACACCAAGTCAGGGAAAGGAAGG - Intergenic
970990876 4:22211702-22211724 ACAGCATCTCAGGGCCAAGCTGG - Intergenic
971407072 4:26331584-26331606 ACAGCAAACGAGGAAAGAGCAGG - Intronic
971775695 4:30961643-30961665 ACAAGAAGTCAGGGAAAAGAGGG - Intronic
972059927 4:34856682-34856704 GGAGCAAACCAGGGAAAAGATGG + Intergenic
975940522 4:79639091-79639113 AAAGTAAAGCAGGGTAAAGCGGG - Intergenic
976052330 4:81024028-81024050 TAAGGAAATCAGGGGAAAGCAGG + Intergenic
976838654 4:89405743-89405765 ACAACAAATCATGGAAAAATTGG + Intergenic
978235744 4:106457020-106457042 ACAGCGAATCTGACAAAAGCAGG + Intergenic
979600604 4:122583217-122583239 CCAGCAAACGTGGGAAAAGCAGG + Intergenic
980873224 4:138633730-138633752 AAACCAAATCAAAGAAAAGCTGG - Intergenic
980886587 4:138769048-138769070 ACAACAAATCAGGGAATTGTTGG + Intergenic
980900575 4:138901452-138901474 ACAGCAAAGCAGGTAAAGGTGGG + Intergenic
982473548 4:155823282-155823304 ACAGGAAATCATGGAAAAGTAGG - Intergenic
983063581 4:163185384-163185406 TCACCAACTCAGGAAAAAGCTGG - Intergenic
984542424 4:181056149-181056171 ACAACAAATTGGGGAAGAGCAGG - Intergenic
984979811 4:185269344-185269366 ACAGCAAATCCAGGAACAGCAGG - Intronic
985358910 4:189151296-189151318 ACAGCAAACATAGGAAAAGCAGG - Intergenic
985937749 5:3109760-3109782 ACAGCCTGTCTGGGAAAAGCTGG + Intergenic
986761309 5:10882403-10882425 GCAGGAAATCAGGAAAAAGATGG + Intergenic
988712602 5:33793676-33793698 ACAGCAACTCAGGGAAGTGGGGG + Intronic
989765604 5:45079087-45079109 ACAGCAGAACAGGGTACAGCAGG + Intergenic
990527111 5:56638831-56638853 AAAGCAGATCAGGGAAGAGTGGG - Intergenic
992306306 5:75442658-75442680 ACATGAAACCAGGGAAAAGAGGG - Intronic
993041892 5:82823961-82823983 TCAGCCTTTCAGGGAAAAGCAGG + Intergenic
993192333 5:84698363-84698385 ACAGCAAAACATTAAAAAGCAGG + Intergenic
993338491 5:86691830-86691852 TCAGCATACCAGGGAGAAGCAGG - Intergenic
993778445 5:92033064-92033086 ACAGCAAAAAATGGAAAAGAAGG - Intergenic
993994233 5:94701750-94701772 ACAGAAAAGCAGGGAGAAACTGG + Intronic
994318100 5:98357751-98357773 AGAGGAAATCAGGGAAAAGGTGG + Intergenic
994384603 5:99115444-99115466 ACAGAAGATGAGGAAAAAGCAGG + Intergenic
994675572 5:102817114-102817136 ACAGTAAATGAGGGAAAAAGAGG - Intronic
995430245 5:112066816-112066838 ACATCAAACATGGGAAAAGCTGG + Intergenic
996010735 5:118479066-118479088 TCAGGGAAGCAGGGAAAAGCCGG - Intergenic
996125172 5:119717901-119717923 ACAGCAAATGTGGGATATGCAGG - Intergenic
998145480 5:139725344-139725366 ACAGCAATGCAGGGAACGGCAGG - Intergenic
998318684 5:141208949-141208971 CCAGCAAAACAAAGAAAAGCAGG - Exonic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999324148 5:150632709-150632731 ACAGCAAGATAGGGACAAGCAGG - Intronic
1000842414 5:166237195-166237217 ATAGCAAAGCAGGGAACAACAGG + Intergenic
1001633504 5:173193807-173193829 ACAGCAAACCAGGCTGAAGCTGG - Intergenic
1002884908 6:1285037-1285059 ACAAGAGATGAGGGAAAAGCTGG + Intergenic
1002965385 6:1960958-1960980 AAAGGAAATCTGGAAAAAGCAGG + Exonic
1003613599 6:7635342-7635364 ACTGCAAATCACAGTAAAGCCGG - Intergenic
1004919172 6:20360019-20360041 ACAGCAAAACAGGGAAAAGGAGG + Intergenic
1005891890 6:30147035-30147057 GCACCAAACCAGGGAACAGCTGG + Exonic
1006374748 6:33665660-33665682 AGAGCATTTCAGGGGAAAGCCGG + Intronic
1006375976 6:33671829-33671851 TAAGCAAATCTGGGAAAAGAAGG - Intronic
1006838139 6:37011559-37011581 ACAGCAACCCCGGGAAAAGAAGG - Intronic
1007250003 6:40489116-40489138 ACAGCACACCAGGAAAAAGCAGG + Intronic
1008993381 6:57629644-57629666 ACAGGAATTCAGGGAATAGATGG - Intronic
1009181986 6:60528733-60528755 ACAGGAATTCAGGGAATAGATGG - Intergenic
1011077373 6:83451319-83451341 ACAGTAAAGCAGGCAAAAGCAGG - Intergenic
1011854571 6:91673343-91673365 ACAGCTCATCAGGGATAAGCTGG - Intergenic
1012679295 6:102158598-102158620 AAAGCAAATCAGACAAAAGAAGG + Intergenic
1012948890 6:105496413-105496435 CCAGCAGATCAGGGCAAAGGAGG + Intergenic
1013428494 6:110035632-110035654 TCAGCAAACCAGGGAACAGGTGG - Intergenic
1013556887 6:111265147-111265169 ACAGCAAAGCAGGGAAGGGAGGG - Intronic
1015942085 6:138462789-138462811 AGTGCAAAGCAGGGAAAAGGTGG + Intronic
1018051856 6:160016191-160016213 ACAGCATAGCAGGCAATAGCAGG - Intronic
1018833036 6:167460616-167460638 ATAGCCAATCAGGGAAATGGTGG + Intergenic
1020038755 7:4985350-4985372 AAAGCAAATCAGGAAGGAGCAGG - Intronic
1022527781 7:31049614-31049636 ACCTCAAGGCAGGGAAAAGCTGG + Intergenic
1024735240 7:52297074-52297096 AAAGCAGATCAGGGAAGACCTGG + Intergenic
1024847918 7:53671587-53671609 ACAGCATATTAGTGAAGAGCTGG - Intergenic
1024849644 7:53696453-53696475 ACAAGAATTCAGGGAGAAGCTGG + Intergenic
1025162540 7:56675322-56675344 ACTTCATATCAGTGAAAAGCAGG + Intergenic
1026676500 7:72432941-72432963 ACAGCACATCAAGGAGAGGCGGG + Intronic
1026977113 7:74505623-74505645 AAATCGAATCAGGGCAAAGCAGG - Intronic
1027924295 7:84440748-84440770 GCAGCAAATCCTGGAAAGGCAGG + Intronic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1029925063 7:104306954-104306976 ACAGCTCATCAGAGAAGAGCCGG + Intergenic
1030224874 7:107139037-107139059 AGAGCAAATCAGAGAAAAATGGG - Intronic
1030443222 7:109615289-109615311 TCAGCAAATGAGGGAAAATGTGG - Intergenic
1031122422 7:117737373-117737395 AACACAAATCAGGGAAAAGCTGG - Intronic
1032306558 7:130738285-130738307 ACAGTACATCAAGGCAAAGCAGG - Intergenic
1033209854 7:139452813-139452835 AAAGGAAATCAGAGAAATGCAGG - Exonic
1033866880 7:145699955-145699977 ACTGCAAATTAGGGAAATGAGGG - Intergenic
1033966753 7:146984398-146984420 AAAGCAACGGAGGGAAAAGCAGG - Intronic
1033972906 7:147065122-147065144 ATAGCTAATAAGGGAAGAGCTGG - Intronic
1036430486 8:8685301-8685323 ACAGCAAGACAGGGAAAAGAAGG - Intergenic
1036612448 8:10362077-10362099 ACAGCAAGTGAGGGCAAAGTTGG - Intronic
1037064583 8:14561733-14561755 CCTGCAATTCAGGGAAGAGCTGG + Intronic
1037467897 8:19177882-19177904 AAAGCACATGAGGGAAAAGAGGG - Intergenic
1037931690 8:22884528-22884550 AGAGTTAATCAGGGAAGAGCTGG + Intronic
1042098162 8:65242088-65242110 ACAGCAAAGCAAGGACAAGGAGG + Intergenic
1043824879 8:84914781-84914803 ACTACAAATCAGGGAAAAGCAGG + Intronic
1043913733 8:85895718-85895740 ACAGAAAAACAGGGGAAAGCAGG - Intergenic
1046590678 8:116202375-116202397 ACAGTAAATCAGCTAAAATCTGG - Intergenic
1047636779 8:126772315-126772337 TCAGCAAATCAGTGGAAACCAGG - Intergenic
1048600248 8:135912073-135912095 ATAGGAAATCAGGGAAGAACAGG + Intergenic
1049044561 8:140139175-140139197 ACAGCAAGTCAGGGAATGGTGGG + Intronic
1051517765 9:17949866-17949888 ACAGCAAAAGACGGAAAAGCAGG + Intergenic
1051858189 9:21593779-21593801 ACAGTTATTCAGAGAAAAGCAGG + Intergenic
1051899346 9:22022474-22022496 AATGCAAATCAGAAAAAAGCAGG - Intronic
1052734174 9:32323220-32323242 TTAGCAAAGCAGGGAAAGGCAGG + Intergenic
1053442394 9:38127154-38127176 CCAGCAAATCAGGGCAGCGCTGG + Intergenic
1055124680 9:72705475-72705497 AAATCAAATCAGGGCAAAGGAGG + Intronic
1055365367 9:75538660-75538682 ACAGCCGAACAGGCAAAAGCTGG - Intergenic
1055530980 9:77183402-77183424 AAAGCAAATCAGCAAAAACCTGG - Intronic
1055551520 9:77436060-77436082 ACAGCAAGCCAGAGAAAAGGAGG + Intronic
1056143825 9:83709400-83709422 ACAGCATGACAGGGAAAAACAGG - Intergenic
1056712267 9:89000679-89000701 CCAGTTACTCAGGGAAAAGCAGG - Exonic
1057473550 9:95379836-95379858 AGAGCAAATGAGAGAAAAGGTGG - Intergenic
1058020480 9:100081246-100081268 AATGCAAATAATGGAAAAGCTGG + Intronic
1058966251 9:110041651-110041673 AGAGGAAATAAAGGAAAAGCAGG + Intronic
1061126951 9:128683241-128683263 ACAGAGAAAGAGGGAAAAGCAGG - Intergenic
1061568144 9:131457969-131457991 ACTGCAGATCAGAGAAAAGCGGG - Intronic
1186004438 X:5052412-5052434 ACAGCAATACAGGAGAAAGCTGG + Intergenic
1186839426 X:13470190-13470212 ACAGCCACTCAGGGAAGAGCAGG - Intergenic
1187564981 X:20440399-20440421 ACAGCAAGGCAGGGAAGAGGAGG - Intergenic
1189431211 X:40949362-40949384 TCAGGAGATCAGGGACAAGCAGG + Intergenic
1190873518 X:54444333-54444355 ACAGCCAATCCTGGAAAAGCTGG + Intronic
1192333761 X:70200773-70200795 ACACAAATCCAGGGAAAAGCAGG + Intronic
1192943726 X:75941582-75941604 ACAGCAAATAAGGGAAGTGAAGG - Intergenic
1192981961 X:76353756-76353778 TCAGGAAATTAGGGGAAAGCTGG - Intergenic
1193277417 X:79605266-79605288 ACAGCAAATTAAGAAAAACCAGG + Intergenic
1194468178 X:94257876-94257898 CCAGAAAAGTAGGGAAAAGCTGG - Intergenic
1195641050 X:107175290-107175312 AAAACAAAGCAAGGAAAAGCAGG + Intronic
1195652868 X:107304082-107304104 ACAGCAAATCTAGAGAAAGCTGG + Intergenic
1195775477 X:108399469-108399491 ACTACAAATCAGGGAAAACTGGG + Intronic
1196193032 X:112813872-112813894 ATACAAAATCAGGGAAAAGCCGG + Intronic
1196503806 X:116416819-116416841 ACAACAAGTCAGGGAAAAAGTGG - Intergenic
1196756989 X:119166675-119166697 ACAGAGGATCAAGGAAAAGCAGG - Intergenic
1198491825 X:137148742-137148764 ACAGGAAATCAGGGAAAATAGGG - Intergenic
1199664296 X:150084251-150084273 AGAGCAAGGCAGGGCAAAGCTGG - Intergenic