ID: 1097646236 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:62237908-62237930 |
Sequence | GTTCAGCAACACCAAGATGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 193 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 27, 4: 163} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1097646236_1097646238 | 2 | Left | 1097646236 | 12:62237908-62237930 | CCTACATCTTGGTGTTGCTGAAC | 0: 1 1: 0 2: 2 3: 27 4: 163 |
||
Right | 1097646238 | 12:62237933-62237955 | CCAATCTGCTTTTACGTCTCTGG | 0: 1 1: 0 2: 1 3: 4 4: 59 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1097646236 | Original CRISPR | GTTCAGCAACACCAAGATGT AGG (reversed) | Intronic | ||