ID: 1097646236

View in Genome Browser
Species Human (GRCh38)
Location 12:62237908-62237930
Sequence GTTCAGCAACACCAAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097646236_1097646238 2 Left 1097646236 12:62237908-62237930 CCTACATCTTGGTGTTGCTGAAC 0: 1
1: 0
2: 2
3: 27
4: 163
Right 1097646238 12:62237933-62237955 CCAATCTGCTTTTACGTCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097646236 Original CRISPR GTTCAGCAACACCAAGATGT AGG (reversed) Intronic