ID: 1097646236

View in Genome Browser
Species Human (GRCh38)
Location 12:62237908-62237930
Sequence GTTCAGCAACACCAAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097646236_1097646238 2 Left 1097646236 12:62237908-62237930 CCTACATCTTGGTGTTGCTGAAC 0: 1
1: 0
2: 2
3: 27
4: 163
Right 1097646238 12:62237933-62237955 CCAATCTGCTTTTACGTCTCTGG 0: 1
1: 0
2: 1
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097646236 Original CRISPR GTTCAGCAACACCAAGATGT AGG (reversed) Intronic
901768915 1:11520777-11520799 GTCCAGCAGCACCTGGATGTTGG - Exonic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
905976061 1:42174667-42174689 GTTCTCCAACAACAAAATGTGGG + Intergenic
908113927 1:60923144-60923166 GGTAAGCAACACCCACATGTTGG - Intronic
908489476 1:64628757-64628779 ATAAAGCAACCCCAAGATGTGGG - Intronic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916755544 1:167766669-167766691 GTTGATCACCACCTAGATGTTGG + Intronic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
920930855 1:210386597-210386619 GTTCAGCACTACCAGGATGGAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1062943593 10:1443290-1443312 CTTCAGCAAGAACCAGATGTAGG - Intronic
1068277088 10:54813921-54813943 GTTCAGAATCACTAAAATGTAGG - Intronic
1068701537 10:60025061-60025083 ACTCAGCAACACCAAGGTGGAGG + Intergenic
1069675453 10:70243570-70243592 CTGCAGCAAGACCAAGATGGTGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1069904634 10:71725104-71725126 GACCATCAACACCAAGATGAAGG + Intronic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070963289 10:80514293-80514315 ATGCAGCAACTCCTAGATGTTGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1072880404 10:99221256-99221278 GTTAAGCAACAACTAGAAGTGGG + Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1079814007 11:25032349-25032371 ATTTAGCAACACCATGATTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1082077337 11:47984520-47984542 TTTCAGAAATACCAAGAGGTAGG + Intronic
1083980362 11:66162608-66162630 GAAGAGCAACACCAAGGTGTAGG - Intronic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096678212 12:53237063-53237085 GCTCAGGACCACCAAGATCTGGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1099426297 12:82527552-82527574 GTTCTGTAACACCAACATCTTGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101985191 12:109440557-109440579 GTTAAGCAACAGCAAAAAGTTGG + Intronic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1107648806 13:42523438-42523460 GTGGAGCAAAACCAAGATGGTGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116029671 14:39555632-39555654 GTTCATCAACACCAAGGAGCGGG - Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1117742969 14:58836765-58836787 GTTCAGATACACCAAGATGAAGG - Intergenic
1117833267 14:59776115-59776137 GCTCAGCAACATCATAATGTTGG - Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1124414768 15:29466107-29466129 GATCAGGAAAACCAAGATGATGG + Intronic
1128065962 15:64764617-64764639 GTACAGCAAGAACAAGAGGTGGG + Intronic
1129954015 15:79617126-79617148 GTTCAGCAGCTCCAGGATGCAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132248260 15:100314737-100314759 GTTCAGAAACACCAAGTTATTGG + Intronic
1135831235 16:25775532-25775554 TTTCAGACACAGCAAGATGTGGG - Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1147681803 17:42253602-42253624 ATTCAGCAACACCAATACCTTGG - Intronic
1148020268 17:44548625-44548647 GCTGAGCAAGACCAAGGTGTGGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1152511059 17:80788877-80788899 GCTCAGCAACACTCTGATGTAGG + Intronic
1153127006 18:1805509-1805531 GTTCAGAAATAGCAAGATGCAGG - Intergenic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156518989 18:37705612-37705634 GATCAGTGCCACCAAGATGTGGG - Intergenic
1157873039 18:51247784-51247806 GTTTAGCAACACCAAGGTTAAGG - Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159075597 18:63678142-63678164 TTTAAGAAACATCAAGATGTAGG + Intronic
1161724112 19:5918588-5918610 GATCCTCAACACCAAGCTGTGGG - Exonic
1161818456 19:6515074-6515096 CTCCGGCACCACCAAGATGTTGG - Intergenic
1164930069 19:32168527-32168549 ATTAAGAAACAACAAGATGTGGG - Intergenic
1165502666 19:36202553-36202575 GTTTAGCATCACTAAGATGGGGG - Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1167386784 19:49168300-49168322 GTACAGCCACACCAACATGCCGG - Exonic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927997492 2:27496197-27496219 ATACACCAACACTAAGATGTTGG - Intergenic
928290325 2:30031071-30031093 TGTCAGCGACACCCAGATGTTGG + Intergenic
928325838 2:30318907-30318929 TCACAGCAACACTAAGATGTAGG + Intronic
929346472 2:40890364-40890386 CTGAAGCAACACCAAGCTGTGGG - Intergenic
933245938 2:79975003-79975025 GTTCAGGAACATCAAGAGGCTGG + Intronic
938759634 2:134412285-134412307 GAAAATCAACACCAAGATGTTGG + Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
948371702 2:237493866-237493888 ATTCTGAAACACCTAGATGTTGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1170911573 20:20575804-20575826 GTTCTGCAACTTCAAGAAGTTGG + Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1173210017 20:41024903-41024925 GTGCAGCATCTCCAAAATGTAGG - Intergenic
1173234606 20:41233239-41233261 GTTAAGCAACACCTAAATGGGGG + Intronic
1177469591 21:21542168-21542190 GTTCAGCAACTACTATATGTGGG - Exonic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1183197622 22:36364329-36364351 GTTCAGCACCTCCCATATGTGGG - Intronic
1184373616 22:44098082-44098104 GTTCAGCGAGAGCAAGGTGTGGG + Intronic
1185305929 22:50116125-50116147 GCTCATCAACATCAAGCTGTGGG + Intronic
950740257 3:15045274-15045296 TTTCACCAACACCAAGAACTGGG - Exonic
953055393 3:39383749-39383771 CTGCTGCAACCCCAAGATGTCGG + Exonic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956050474 3:65242764-65242786 GTTATGCACCACCAAGATTTGGG + Intergenic
956502375 3:69900344-69900366 GTTCAGAAACAGGAAAATGTAGG - Intronic
957332963 3:78789936-78789958 GTTAAGCTAGCCCAAGATGTTGG - Intronic
960007127 3:112791595-112791617 TTCTAGGAACACCAAGATGTTGG - Intronic
961773441 3:129267075-129267097 CTTCAGCAACACCAAGATACTGG - Exonic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
962880893 3:139575481-139575503 GCTCAGCAACTCCAAGAGGTAGG - Intronic
963010766 3:140768193-140768215 TTTCAACAACACCATGAGGTTGG + Intergenic
965137590 3:164791902-164791924 GTGCAGCAACACTAATATATTGG - Intergenic
965816704 3:172643852-172643874 GTTCCTCAACACCGAGCTGTAGG + Intronic
966194342 3:177298315-177298337 CTTCAGCCACACAAAGATGCAGG + Intergenic
967382814 3:188879314-188879336 GTACAGCAACACTAATAGGTAGG - Exonic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969129842 4:4983310-4983332 GTGCAGGGACACCAAGATGTGGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
973029749 4:45322590-45322612 AAACAGCAACAACAAGATGTGGG - Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
974977573 4:68909525-68909547 TTTCAGCAACCCCATGAGGTCGG + Intergenic
975732331 4:77349769-77349791 GTGTAGCCACATCAAGATGTGGG + Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981503386 4:145475878-145475900 TTTGAGCAATGCCAAGATGTAGG - Intergenic
981532904 4:145769725-145769747 CTTCAGCATCACAAAGATCTTGG + Intronic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983738431 4:171093115-171093137 ATTCAGCAAAAGCATGATGTTGG + Intergenic
984087130 4:175326887-175326909 GTACATCGACACCAAAATGTGGG - Intergenic
984163644 4:176283359-176283381 GTTCAGGAACTCCAAGATTTAGG + Intergenic
988161887 5:27528922-27528944 GTTCAACAAAACCAAGAGTTGGG - Intergenic
990399676 5:55425820-55425842 GTTTAGCAATATCAAGATGTAGG + Intronic
992313343 5:75526304-75526326 CTTCAGCAAAAACAAGATTTAGG + Intronic
993942168 5:94072441-94072463 GTACATCAAAACCAAGATATTGG - Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995951956 5:117725862-117725884 GGTCAGAAACACTAAGATCTTGG + Intergenic
996069126 5:119114333-119114355 TTTCAGGTACACAAAGATGTGGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997109686 5:131061090-131061112 GTTCACAATCACCAAGATATAGG + Intergenic
997487277 5:134242052-134242074 CTTCAACAACACCAAAAAGTAGG - Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000255220 5:159531201-159531223 CATCAGCAAGATCAAGATGTGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003561174 6:7181956-7181978 TTCCATCAACACCATGATGTCGG + Exonic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1009407304 6:63327910-63327932 GTGCAGGAACACAAAGAGGTGGG - Intergenic
1010674445 6:78724582-78724604 TTTCAGCAACAGCAATATTTTGG + Intergenic
1014404844 6:121038283-121038305 GTTCAGCAACAGAAATACGTAGG + Intergenic
1015261356 6:131241200-131241222 GATCAGCAAGACCAATAAGTAGG + Intronic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017396219 6:154002637-154002659 CTTCAGGAACTCCAAGATCTGGG + Intergenic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019072159 6:169355784-169355806 TTCCTGCAACACCAAGATGCTGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1025716977 7:63967681-63967703 GTTCAACAACAAAAAAATGTAGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1031870692 7:127087218-127087240 TTAGAGCAACACCAAGCTGTGGG + Intronic
1034595156 7:152182445-152182467 GTTCAGATACACCAAGTAGTGGG - Exonic
1036594177 8:10197468-10197490 GATCAGCAACCCTAAGAAGTGGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1042311630 8:67384677-67384699 GTTCAGAAAGATCAAGATTTCGG - Intergenic
1045074361 8:98546727-98546749 TTTCAGGAAATCCAAGATGTAGG + Intronic
1047018534 8:120749743-120749765 GCTCAGCAACTGCAATATGTGGG + Intronic
1047913838 8:129560423-129560445 TTACAACAACACCATGATGTAGG - Intergenic
1048169622 8:132093499-132093521 GTTGAGCAACGGCAAGTTGTTGG + Intronic
1050321233 9:4454514-4454536 GTTGGGAAACAGCAAGATGTAGG - Intergenic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055196894 9:73605671-73605693 GTTCAGAAACACCAAAATAGGGG + Intergenic
1055319528 9:75068622-75068644 GTTCTGCGACACCAAGTTCTAGG - Intronic
1056034029 9:82584904-82584926 GTGCAGCAACCCCACAATGTAGG + Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1058913080 9:109539106-109539128 GTTCTGCAGCAGCAAGATCTTGG - Intergenic
1059985528 9:119816905-119816927 GTTTAGCAACACGAAGATATTGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060234766 9:121854522-121854544 GTTCAGAAGCCCCCAGATGTTGG + Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1193388101 X:80894513-80894535 GCTCAGAAACAGAAAGATGTGGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1197052614 X:122077762-122077784 GCTCAGCCACAGCAAGATATAGG - Intergenic
1197822866 X:130559319-130559341 CTTTGGCAACACCCAGATGTAGG + Intergenic
1199908848 X:152262678-152262700 GCTCAGAAACAGGAAGATGTGGG - Intronic
1200357067 X:155563013-155563035 GTTCAGAAACAAGAAGATGTGGG - Intronic
1200416141 Y:2912276-2912298 GTTGAGCAACAGCAAGGGGTGGG + Intronic