ID: 1097668240

View in Genome Browser
Species Human (GRCh38)
Location 12:62506000-62506022
Sequence GTGGAGAAGTAGAGTTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097668236_1097668240 7 Left 1097668236 12:62505970-62505992 CCACAGAGATCATGATGAGTATA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG 0: 1
1: 0
2: 2
3: 31
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097668240 Original CRISPR GTGGAGAAGTAGAGTTGGGA TGG Intronic
901444261 1:9297895-9297917 GTTGAGAAATAGATTTGTGAGGG + Intronic
901658701 1:10785568-10785590 GAGGAGAAGCAGAGGTGGGGTGG - Intronic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
903313654 1:22482386-22482408 GTGGAGAATGGGAGTGGGGAGGG - Intronic
903895262 1:26598825-26598847 TAGGAGAAGTTGAGCTGGGAAGG + Intergenic
906186703 1:43867565-43867587 GTGGTGAAGTTGTGTGGGGAAGG + Intronic
906281154 1:44554776-44554798 GTGGTGAAGGTGAGCTGGGAGGG - Intronic
907263285 1:53238258-53238280 GTGGGGAACTAGAGGAGGGAGGG - Intronic
908537622 1:65092803-65092825 GTGGAGAAGTAAGGTAGAGAAGG - Intergenic
908563286 1:65328729-65328751 GTGGAACCTTAGAGTTGGGAAGG + Intronic
908938178 1:69400697-69400719 GTTGAGATTTAAAGTTGGGATGG + Intergenic
911721647 1:101197619-101197641 GTGGAGAACTAGATTGGAGATGG - Intergenic
911768604 1:101710517-101710539 GGGGAGAAGAAGAGATGGTAGGG - Intergenic
912782353 1:112563002-112563024 TCAGAGAAGTAGAATTGGGAGGG + Intronic
912916186 1:113816957-113816979 GAAGAGAAGGAGAGTAGGGAAGG + Intronic
913164053 1:116168976-116168998 GTGGAGTAGTGGAGGGGGGACGG - Intergenic
913993468 1:143635901-143635923 GTGGGGAACTAGAGTTGGTTGGG + Intergenic
914241324 1:145854904-145854926 GTGGAGAAGTGGCTCTGGGAAGG + Intronic
914361884 1:146943148-146943170 GTGGGGAACTAGAGTTGGTTGGG - Intronic
914489740 1:148143807-148143829 GTGGGGAACTAGAGTTGGTTGGG + Intronic
915046706 1:153023426-153023448 GTGGACAAGTAGTGTTGGCACGG + Intergenic
915084104 1:153373037-153373059 GTAGAGAAGTAGAGTTGGGGTGG - Intergenic
915230158 1:154439669-154439691 CTGGAGAAGTAAAGTGGTGATGG - Intronic
915304790 1:154970952-154970974 GGGGAGAAGTAAAGTGGGGGTGG + Intronic
916502160 1:165396508-165396530 GTGGGGAGGGAGAGCTGGGAGGG - Intergenic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917123459 1:171664823-171664845 GAGGAGAAGTAGGTTTGGAAAGG - Intergenic
917537481 1:175884867-175884889 GGGGAGAATGGGAGTTGGGATGG - Intergenic
917942265 1:179934233-179934255 GTGCAGAAGTAGTCTTGGGTAGG + Intergenic
918107532 1:181426999-181427021 GTGAAGAAGCTGAGGTGGGAAGG - Intronic
918211852 1:182358232-182358254 AGGGAAGAGTAGAGTTGGGATGG + Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
919848409 1:201655971-201655993 GTGCTGAGGTAGAGATGGGAGGG + Intronic
920371752 1:205483524-205483546 GAAGAGAACTAGAGGTGGGAGGG - Intergenic
921319863 1:213928174-213928196 GTAGAGAAGTAGATATGGGCAGG - Intergenic
921489969 1:215763341-215763363 GGGGAGAAGTGGAGATGGGTAGG + Intronic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923579895 1:235199548-235199570 GTGGAGAATTAGAGAAGAGAAGG + Intronic
1063385229 10:5612389-5612411 GTGGGGAAGTGGAGATGGGAAGG - Intergenic
1063457094 10:6191546-6191568 GCTGAGAGGTAGAGCTGGGATGG + Intronic
1063501073 10:6555116-6555138 GGGGACAAGTAAAGGTGGGAGGG + Intronic
1064344683 10:14521384-14521406 GTGGGGAAGTAAAGTTGTCAGGG - Intronic
1065753585 10:28910653-28910675 GAGGAGAAGAAGGGTTGGGAAGG - Intergenic
1067705011 10:48599969-48599991 GTGCAGCACTAGATTTGGGAGGG + Intronic
1068080896 10:52315612-52315634 ATGGAGAAGTCAAGTTGTGAGGG - Intronic
1069361920 10:67652903-67652925 TAGGAAAAGTAAAGTTGGGAAGG - Intronic
1070078481 10:73161989-73162011 GGGGAGAAGAAGAGTTGGTTGGG - Intronic
1070666789 10:78350607-78350629 GGGGAGAAGTAGAGAAGGAAAGG + Intergenic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072285018 10:93905857-93905879 GAGCAGAAGTAGACTTGGGCAGG + Intronic
1072577214 10:96711246-96711268 GTGGTGCAGGTGAGTTGGGAAGG - Intronic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1072808804 10:98444236-98444258 GTGGGGAAGGAGATTTGGGAGGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073036295 10:100566445-100566467 GTGGAGAAGTTCAGCTGGAAAGG + Intergenic
1073768415 10:106708769-106708791 GTGGAGAAGCAGGAATGGGAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073913180 10:108370948-108370970 GTGGACCAATAGAGTGGGGAAGG + Intergenic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074847360 10:117410120-117410142 GTGGAGAGGTAGAGGTTGGGAGG + Intergenic
1074978321 10:118598788-118598810 GTGGACAGGTAGAGTTGAGTGGG - Intergenic
1075055496 10:119215443-119215465 GGGGAGAAGGAGAGATGAGAGGG + Intronic
1075838620 10:125477723-125477745 GGGGGGAAGTGGAGTGGGGATGG + Intergenic
1076617218 10:131763329-131763351 GTGGAGAAGCAGGCTTGGTAGGG + Intergenic
1076663347 10:132069789-132069811 GTGGTGATGTTGGGTTGGGAAGG + Intergenic
1076707508 10:132309688-132309710 GTGGTGAAGGAGCGTTTGGAAGG + Intronic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1078895452 11:15593281-15593303 GTGGATGAGAAGAGCTGGGAGGG - Intergenic
1079481558 11:20886093-20886115 GTGGACTACTAGAGGTGGGAGGG + Intronic
1079688222 11:23388848-23388870 GTGGAGAAGTAGGGTTGAATAGG - Intergenic
1080162509 11:29194144-29194166 GTGGAGGAATAGATTTGGTATGG - Intergenic
1080573329 11:33576808-33576830 GAGGATAAGTGGGGTTGGGATGG + Intronic
1080808739 11:35681561-35681583 GTGGAGAAGTACAGATAGCAGGG + Intronic
1081593666 11:44444521-44444543 GTGGAGAGGCAGAGGTGGAATGG + Intergenic
1081623445 11:44632772-44632794 GTGGACAAGTAAATCTGGGAAGG + Intergenic
1081718841 11:45271521-45271543 TTGGAGAAATGGAGTTGGAAAGG + Intronic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082132825 11:48512104-48512126 GTGGAGAAATAGAATTGTCAAGG + Intergenic
1082138547 11:48579219-48579241 GAGGAGAAGTAGAATTGTCAAGG + Intergenic
1082566260 11:54682659-54682681 GTGGAGAAATAGAATTGTCAAGG + Intergenic
1083053118 11:59794547-59794569 GGGGAAAAGAAGAGGTGGGATGG - Intronic
1084294441 11:68202397-68202419 CTGGAGAAGTGGGGTTGGGCAGG - Intronic
1084594065 11:70106781-70106803 GTGGAGGAGAGGAGTGGGGAAGG - Intronic
1084884679 11:72195932-72195954 GTGGGGAAGTAGAAATGGAAAGG - Exonic
1086723650 11:90153010-90153032 GTGGGAAGGAAGAGTTGGGAGGG - Intronic
1088055477 11:105571287-105571309 CGGGAGAAGTAGATTTGGGTGGG + Intergenic
1088277647 11:108104669-108104691 CAGGAGAAATACAGTTGGGAAGG + Exonic
1088848560 11:113687706-113687728 GTGGAGAGGGAGAGTGGAGAGGG + Exonic
1089330559 11:117686170-117686192 GTGGAGAGATGGAGCTGGGAAGG + Intronic
1089645054 11:119873539-119873561 GGAGAGAAGAAGAGTTGGGTGGG + Intergenic
1089806198 11:121093047-121093069 GGGAAGAAGTAGAGTTGAGCAGG + Intergenic
1090613429 11:128492720-128492742 TTGGAGGTGTAGAGTGGGGATGG - Intronic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1091172856 11:133533570-133533592 GTGGACACGTGGAGCTGGGAAGG - Intergenic
1091821109 12:3475745-3475767 GTGGAGGGGGAGGGTTGGGATGG + Intronic
1092083854 12:5739677-5739699 CTGGAGAAGTAAAGTAAGGATGG + Intronic
1092251027 12:6897006-6897028 GTGGAGAAGTCCAGATGGTAAGG + Intronic
1094138616 12:27156527-27156549 GTGGAGAAGTAGTGTAGTGTTGG - Intergenic
1094433907 12:30399775-30399797 GGTGACAAGCAGAGTTGGGAGGG - Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095143531 12:38696218-38696240 CTTGAGAGGTAGAGGTGGGAGGG - Intronic
1096456076 12:51788135-51788157 CTGAAGGAGTAGAATTGGGAAGG + Intronic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1098814211 12:75137015-75137037 GAGTTGAAGAAGAGTTGGGAAGG - Intronic
1101256513 12:102982876-102982898 TTAGAGAAGTGGAGTGGGGAAGG + Intergenic
1101919570 12:108921447-108921469 GTGGGGAAGTAAATTTGGGAAGG + Intronic
1103364387 12:120370715-120370737 GAGTAGAAGGTGAGTTGGGAGGG - Intergenic
1103871260 12:124093872-124093894 GTGGGGAAGTCAAGTGGGGAAGG + Intronic
1104119744 12:125787870-125787892 GTGCTGATGTATAGTTGGGATGG - Intergenic
1105384903 13:19920610-19920632 GGAGAGAAGGAGAGTCGGGAGGG + Intergenic
1105639060 13:22243909-22243931 GTGGAGAACTAGAGTGGCCATGG + Intergenic
1108387585 13:49914718-49914740 ATAGAGATGTAGAGTTGGGTGGG - Exonic
1108556293 13:51596104-51596126 GGGGAGAAGGAGTGTTGGAATGG + Intronic
1108594513 13:51938000-51938022 GTGAAGCAGGAGAGTAGGGAGGG - Intronic
1108703647 13:52965438-52965460 GAGGGGAAGTAGAGATGGCATGG - Intergenic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1110050847 13:70897084-70897106 GTCGAGAAGCAGAGATGGCAAGG + Intergenic
1110972921 13:81788958-81788980 GGGGAGACGTAAAGTGGGGATGG + Intergenic
1111949376 13:94698633-94698655 TTGGTGAAGTGGAGTTGGGGAGG + Intergenic
1112569092 13:100577800-100577822 GGGGAGAAGGAAAGTAGGGAGGG + Intronic
1113058010 13:106290329-106290351 GTGGAGAACTGAATTTGGGAAGG + Intergenic
1113384246 13:109833627-109833649 CTCTAGAACTAGAGTTGGGAAGG - Intergenic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1115012530 14:28566741-28566763 GTGGACTAGTAGAGCTGGGAGGG - Intergenic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1119080509 14:71688940-71688962 CTGGAGGAGTAGACTTGAGATGG - Intronic
1119207656 14:72806715-72806737 GGGGAGAACTAGGGGTGGGAAGG - Intronic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119727138 14:76928365-76928387 GTGGAGGAGGGGAGTGGGGAAGG - Intergenic
1119931483 14:78551767-78551789 GGGGGGAAGTAGAGTGGGGAAGG - Intronic
1120403606 14:84065774-84065796 GTCGAGAAGTTAATTTGGGATGG - Intergenic
1120993160 14:90396645-90396667 TTGGAGATGTTGAGGTGGGAGGG + Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121231379 14:92361343-92361365 GTAGAGAAGCAAGGTTGGGAAGG + Intronic
1121620782 14:95346864-95346886 GTGGGGAGGTGGAGCTGGGAGGG - Intergenic
1124203397 15:27697662-27697684 GTGGGGAAGTGGAGTGGGGGAGG - Intergenic
1124850305 15:33330509-33330531 GGGGAGAGGAAGAGTAGGGAGGG - Intronic
1124872403 15:33556101-33556123 GAGGAAAAGTAGATATGGGAAGG - Intronic
1125524155 15:40364801-40364823 GTGGAGAAGAACAGGTGGGCAGG - Intronic
1126364727 15:47882482-47882504 ATGGAGAAGTAGAGATGTCATGG + Intergenic
1128153284 15:65376833-65376855 GTGGGGAACTTGAGGTGGGAGGG + Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130142214 15:81237000-81237022 ATTGAGAAATAGAGTTGGAAAGG - Intronic
1130328517 15:82901262-82901284 GTGGAGAAGCAAAGCTGAGATGG + Intronic
1130895608 15:88168346-88168368 GGGGAGAAGAAGAGTGGAGATGG + Intronic
1131234729 15:90685624-90685646 GTCAAGAAAAAGAGTTGGGAAGG - Intergenic
1133501546 16:6372107-6372129 ATGGAAAAGTATAGTTGGGTGGG + Intronic
1133697555 16:8279459-8279481 GTGGAGGAGTAGGGTGGGTAGGG - Intergenic
1133907477 16:10035384-10035406 GAGGAGCAGTACAGTTTGGAGGG - Intronic
1134028753 16:10975044-10975066 GAGGAGAAGTAGAGGAGGGCTGG + Intronic
1134176735 16:12013011-12013033 GTGGAGGAGTGGAGGTGGGTGGG + Intronic
1136713463 16:32258719-32258741 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136754448 16:32670712-32670734 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1136813665 16:33199653-33199675 GTGGAGAACTCCAGCTGGGAGGG + Intronic
1136820141 16:33309733-33309755 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136826704 16:33366272-33366294 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1136831770 16:33465043-33465065 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1137010485 16:35315763-35315785 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1137024090 16:35456058-35456080 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1137371225 16:47907538-47907560 GGGGAGAAGTAGAGGAGAGATGG - Intergenic
1137636253 16:49989114-49989136 GCAGAGAAATAGAGTTGGGGTGG - Intergenic
1137810038 16:51343973-51343995 GTGGAGGAATAGTGTGGGGAGGG - Intergenic
1139300206 16:65938599-65938621 CTGGACAGGTAAAGTTGGGAGGG - Intergenic
1140692325 16:77496433-77496455 GTTGAGTAGTAGGGGTGGGAAGG + Intergenic
1141521605 16:84583830-84583852 AAGGAGAAGTGGAGGTGGGAAGG - Intronic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1202992241 16_KI270728v1_random:22627-22649 GTGGAGAACTCCAGCTGGGAGGG + Intergenic
1203056595 16_KI270728v1_random:931043-931065 GTGGAGAACTCCAGCTGGGAGGG - Intergenic
1143092916 17:4459892-4459914 GGAGAGAAGTATTGTTGGGAAGG + Intronic
1143245649 17:5483514-5483536 GTGGAGATGTTGGGTAGGGAAGG - Intronic
1143335187 17:6166888-6166910 GTGGAGAAGTGAGATTGGGAAGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144898794 17:18564187-18564209 GGGGAGAAGTAGGATTGGGAAGG - Intergenic
1145133581 17:20381536-20381558 GGGGAGAAGTAGGATTGGGAAGG + Intergenic
1145297167 17:21600994-21601016 TTTGAGAAGTAGAGTAGGCAGGG - Intergenic
1145366787 17:22271905-22271927 TTTGAGAAGTAGAGTAGGCAGGG + Intergenic
1146405288 17:32531338-32531360 GTGGAGAAAGAGAGCTGGGTTGG + Intronic
1147452699 17:40515808-40515830 GTGGAGGTGGAGAGGTGGGAAGG - Intergenic
1148401325 17:47364198-47364220 ATAGAGAAGTAGAGTTGCCAAGG - Intronic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1149249241 17:54749342-54749364 GTGGAGACATAGAGTTGTGCTGG - Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1153565103 18:6411557-6411579 GTGGAGAAGTAAGGGAGGGAAGG - Intronic
1155407358 18:25503570-25503592 GTGGAGGCTTAGAGATGGGATGG - Intergenic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1156865367 18:41883448-41883470 GTGGAAGTGTAGAGTGGGGATGG + Intergenic
1156901886 18:42309750-42309772 GTGAATAGGTAGATTTGGGATGG + Intergenic
1157168807 18:45383603-45383625 AGGGAGAAGTAGAGAAGGGAAGG - Intronic
1157395203 18:47335540-47335562 GTGGAGAAGGAGGGATGTGAAGG + Intergenic
1157765944 18:50297848-50297870 GTGGAGAAGGAGGCTTGGGGAGG - Intergenic
1157873186 18:51248765-51248787 TTGGAGAAGGGCAGTTGGGAAGG - Intergenic
1158105941 18:53885213-53885235 GTGGAGAAAGAGAGATGGGGTGG + Intergenic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1160372797 18:78388952-78388974 GGGGAGAAATAGATTTGGGTAGG - Intergenic
1160393885 18:78558281-78558303 CTGGAGATGTAGGGTGGGGAGGG - Intergenic
1160729487 19:634458-634480 GTGGGGCAGTAGGCTTGGGAAGG + Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163688981 19:18728247-18728269 GTGGAGAGGCAGAGATGGGCCGG - Intronic
1164561369 19:29294399-29294421 GTGGAGAACTAGAGCTGGGGTGG - Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1167456903 19:49601165-49601187 GTGAGGAAGTAGAGTTAGGGAGG + Intronic
1167854422 19:52226289-52226311 GTGGAGAAGTAAATGGGGGAGGG - Exonic
1168593943 19:57659177-57659199 GCTGAGAAGTAAAGTTGGTAAGG - Intergenic
925222953 2:2157449-2157471 GGGGAAAAGCAGAGGTGGGAGGG + Intronic
925267524 2:2576543-2576565 GGGGAGAAGTGGGGATGGGAGGG + Intergenic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925847221 2:8044778-8044800 GTGGGCCTGTAGAGTTGGGAGGG - Intergenic
927927744 2:27025252-27025274 TTGGGGAAGTAGAGTTGGAAGGG - Intronic
929925896 2:46208313-46208335 GTGGACTACTAGAGGTGGGAGGG - Intergenic
930370979 2:50500920-50500942 TTGGAGAAATAGTGTTGAGAGGG + Intronic
932682564 2:73838387-73838409 TTGGAGAAGTTTAGATGGGAAGG + Intronic
932715088 2:74094896-74094918 GTGGAGATGTGGAGTAGGCAGGG + Intronic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
934858402 2:97743216-97743238 GTGGAGAGCCAGAGGTGGGAGGG - Intergenic
939347122 2:140979948-140979970 GAGGCGAAGAAGGGTTGGGAGGG - Intronic
940868241 2:158838007-158838029 GTGGAGAAGAGGAGGTGAGAGGG + Intronic
946013378 2:216584457-216584479 GTGGAGAGGGAGAGCTGAGAGGG - Intergenic
946217766 2:218198936-218198958 GTGGAGAAGTGGAGGAGGTAAGG - Intergenic
946412015 2:219520163-219520185 GTGGAGAAGGAGGGTCGGGAGGG - Intronic
946412093 2:219520536-219520558 GCAAAGATGTAGAGTTGGGATGG - Intronic
947554593 2:231080179-231080201 CTGGAGAAGTATCCTTGGGAAGG - Exonic
948585232 2:239015119-239015141 TTGGAGAAGTGGAGATGGGATGG + Intergenic
948919351 2:241054174-241054196 GTGGGGAAGTAGCATTGGGAGGG - Intronic
949032103 2:241802150-241802172 GTGCAGAAGGCGGGTTGGGAGGG + Intronic
1168953792 20:1820155-1820177 GTGGAGAACTTGTGATGGGAGGG - Intergenic
1169538333 20:6571527-6571549 GTGGATTACTAGAGTGGGGAGGG + Intergenic
1169813799 20:9635426-9635448 ATGGACAAGTAGAGATTGGATGG - Intronic
1171234608 20:23514055-23514077 GAGGAGAAGCAGATTTGGGCAGG - Intergenic
1172563126 20:35906798-35906820 GTGGAGAAATAGTGTTGGGAAGG + Intronic
1172655379 20:36533656-36533678 GTGGAGATGTCGAGTGGGAAGGG - Intergenic
1172808767 20:37632231-37632253 GGAGAGAAATAGAGTGGGGATGG - Intergenic
1172848358 20:37943913-37943935 GGGGAGAAGAAGAGTCGGGGGGG - Intronic
1173014976 20:39216536-39216558 ATGGATAAGTAGCATTGGGATGG - Intergenic
1173413127 20:42832363-42832385 GTGGAGAGGGAGAGGAGGGAGGG + Intronic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1174109619 20:48189620-48189642 ATGGAAGAGTAGATTTGGGAAGG + Intergenic
1174215341 20:48912073-48912095 GTGGAGAAGTGAAACTGGGAAGG + Intergenic
1174995341 20:55560964-55560986 GGAGACTAGTAGAGTTGGGAGGG - Intergenic
1175547401 20:59787354-59787376 GAGGAGGAGCAGAGGTGGGAGGG + Intronic
1175872023 20:62213343-62213365 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175872188 20:62213737-62213759 GGGGGGAAGGAGAGTGGGGATGG + Intergenic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1176108651 20:63401223-63401245 GTGGAGGAGGAGAGACGGGAGGG - Intergenic
1176222605 20:63977179-63977201 GTGGAGAAGGAGGGCAGGGACGG + Intronic
1177447019 21:21210860-21210882 GAGGAGGGGGAGAGTTGGGAGGG + Intronic
1177686944 21:24449322-24449344 GAGAAGAAGTAGAATTTGGAGGG - Intergenic
1178264534 21:31130602-31130624 GGGGAAAAGTAGCGTTAGGAAGG + Intronic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1180931529 22:19595657-19595679 GTGTAGACTTAGAGTTGGAATGG + Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183557954 22:38546023-38546045 GTGGAGAAGAACAGCTGGGTGGG - Intronic
1184274595 22:43403124-43403146 GTGGAGGAATAGAGTGGGGTTGG + Intergenic
949522534 3:4869776-4869798 TTTGAGAAGTCGAGGTGGGAGGG - Intronic
950428670 3:12938453-12938475 GTGGAGGAGAAGAGCTGGGGGGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952287325 3:31981332-31981354 GAGGCGAAGGAGAGCTGGGAAGG + Intronic
952497099 3:33925388-33925410 GTGGAAACGGAGAGTTGGGATGG + Intergenic
953372947 3:42405760-42405782 GTGGGGTGGTAGAGCTGGGAGGG - Intronic
956980578 3:74632536-74632558 GTGAAGAAGTAGAAATGAGAAGG - Intergenic
959244418 3:103846259-103846281 GTTGAGAAGTAGAGTTCTGGGGG + Intergenic
960416635 3:117393013-117393035 GAGAAGAAGTAGAGTGGGAAGGG - Intergenic
960670029 3:120146804-120146826 GTGGAGAATGAGGTTTGGGAAGG + Intergenic
960708042 3:120500266-120500288 GTGGAGAAGGAAACTTGGGGTGG + Intergenic
962031756 3:131608409-131608431 GTGGGGAAGCTGAGTTGTGAAGG + Intronic
964158369 3:153614777-153614799 ATGGAGAAATAGATCTGGGAAGG + Intergenic
964477713 3:157111534-157111556 GGGGGCAAGTAGAGTGGGGAAGG + Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
970360426 4:15303711-15303733 GTGGAGAGGTTGAGTGGAGATGG - Intergenic
971388013 4:26159372-26159394 GAGGAGAAGCTGAGTTGGGGTGG + Intergenic
971721987 4:30256363-30256385 GTGGAGGGGCAGAGTTGGGTGGG + Intergenic
972318114 4:37946681-37946703 GAGGAGAAGTGGAGTTGTGGTGG + Intronic
973638172 4:52878952-52878974 GAGGAGAAGAAGAGATGGCAGGG - Intronic
974170921 4:58266435-58266457 GGGGAGATCTAGAGTTGGGGAGG - Intergenic
974709961 4:65578193-65578215 GGGGTGGAGTACAGTTGGGAGGG - Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976246310 4:83009748-83009770 GTTAAGAAGGAGAGTTGCGATGG - Intronic
979585526 4:122410980-122411002 GTGGAGTAGTAGAGAAAGGATGG + Intronic
981559054 4:146027043-146027065 GTGGAGAATGAGTGTTGGGTGGG + Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
983232492 4:165143276-165143298 GTGAAGAAATAGTGGTGGGAAGG - Intronic
984273242 4:177574026-177574048 GAGGAAAAGAAGAATTGGGAAGG - Intergenic
984307218 4:178008954-178008976 GTGGACTAATAGAGTGGGGAGGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
985760849 5:1747778-1747800 GTGAAGAAGTAGAGTTGCTAAGG + Intergenic
987817185 5:22917744-22917766 GTGGTGGAGTAGGGTGGGGATGG + Intergenic
987875648 5:23677167-23677189 GAGGAGTACTAGAGTGGGGAAGG + Intergenic
988163648 5:27553360-27553382 GTCAAAAAGGAGAGTTGGGAGGG + Intergenic
989529630 5:42492696-42492718 TTGGAGAAATAGATTTGGAATGG + Intronic
990197539 5:53335452-53335474 GTGGAGCTCTAGAGCTGGGATGG - Intergenic
990378054 5:55192916-55192938 GTCCAGAAGCAGAGGTGGGAGGG - Intergenic
990424944 5:55678002-55678024 GTGGTAAAGTAGAGCTAGGAGGG + Intronic
991237420 5:64416022-64416044 GTGTAGAAATAGAATTGGGGGGG - Intergenic
992375195 5:76181914-76181936 GTGGAGAAATATAATTGGGCTGG - Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
992849973 5:80797193-80797215 GTGGAGAAATAGAGTGGCGAGGG - Intronic
994128224 5:96193967-96193989 GAGGAAAAGTAGAGTTGAGCAGG + Intergenic
994367684 5:98934059-98934081 GGAGAGAAGTAGAATTGGGAAGG + Intergenic
995098599 5:108270955-108270977 GTGGAGAAGGAGAGGGGGAAAGG - Intronic
996087554 5:119320527-119320549 GAGGAGTAGTGGAGTGGGGAGGG - Intronic
997333584 5:133086258-133086280 GGGAAGAAGAAGAGATGGGAAGG - Intronic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997569402 5:134914609-134914631 GTAGGGAAGTACAGTTGTGATGG + Intronic
998813132 5:145986317-145986339 GGGGAGAAGTAGTGGTGGGAGGG + Intronic
999366789 5:151028674-151028696 GTGGGGATGTAGCCTTGGGAGGG - Exonic
999400456 5:151259933-151259955 GTGGAGAAGGGGAGGTGCGAGGG + Intronic
999453623 5:151696930-151696952 GTGGAGAAGAAGAGACGGGTGGG - Intergenic
1002586659 5:180252961-180252983 GTGGAGAAGTAGAGCTGAGGGGG + Intronic
1003488110 6:6597039-6597061 TTGGAGAGGTAGAAATGGGAAGG + Intronic
1003619461 6:7685188-7685210 CTGGAGAAGAAGCCTTGGGATGG + Intergenic
1003705221 6:8520620-8520642 GTGGGGAGGTACAGGTGGGAGGG + Intergenic
1003834602 6:10057537-10057559 GTGGAGAGGTAGTTTTGGCATGG + Intronic
1004702652 6:18093412-18093434 GTGGAAAATAAGAATTGGGAGGG - Intergenic
1005080442 6:21951917-21951939 GTGGAGGAGGAGAGTGGAGATGG + Intergenic
1005991919 6:30908527-30908549 GACGTGAAGTAGACTTGGGAAGG + Intronic
1006215889 6:32442411-32442433 ATGGAGAAAGAGAGTTGGGTGGG - Intronic
1007070182 6:39031038-39031060 CTGCAGAATTGGAGTTGGGAGGG - Intergenic
1007782833 6:44264144-44264166 GATGAGAAATAGAGTTGGGGAGG - Intronic
1007901166 6:45414304-45414326 GTGGAGAAGTGAAGTTGGCTTGG - Intronic
1009943120 6:70312549-70312571 GTGGAGCAGCAGAGATGGAAAGG + Intergenic
1010484825 6:76397621-76397643 TTGGAGAAGCTGAGTTGAGAGGG + Intergenic
1010638017 6:78283947-78283969 GTGCAGAAACAGAGTTGGGGAGG - Intergenic
1010833457 6:80557878-80557900 GGGGAGAAAAAGAGTTGGGAGGG - Intergenic
1012060962 6:94479963-94479985 GTGGAGGAATAGAGATAGGAAGG - Intergenic
1013088255 6:106875168-106875190 GAGGAAAAGGAGATTTGGGAGGG - Intergenic
1013544295 6:111140494-111140516 GTGAAGAAGTGCAGTTGGGCTGG - Intronic
1013651352 6:112198201-112198223 GTGGTGAAGGGGAGTTGGGGAGG + Intronic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1014290319 6:119550832-119550854 GTGGAGAAAAAAATTTGGGATGG + Intergenic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1014884711 6:126765484-126765506 GTGGAAAAGAGGAGTTGGTAAGG - Intergenic
1016868631 6:148795195-148795217 TTTGAGAAGTAGGCTTGGGATGG + Intronic
1016926851 6:149359671-149359693 GTGGGGGAGAAGAGTTTGGAAGG - Intronic
1018438916 6:163789919-163789941 GTGGAGTAGAAGGGTCGGGAAGG + Intergenic
1018834045 6:167470233-167470255 GGTGTGAAGTAGAGATGGGAGGG + Intergenic
1018896712 6:168024538-168024560 GTTGAGAACTAGGCTTGGGATGG + Intronic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021719104 7:23489358-23489380 GTTGAAAAGTAGAGTTCGGCTGG + Intergenic
1022513883 7:30963480-30963502 GTGGAGATGGAGGGTTGGAATGG - Intronic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1022999785 7:35796860-35796882 ATGGAAAATTAGAGTTGAGAAGG + Intergenic
1024175849 7:46840398-46840420 GTGGAGAGGTGGAGTGTGGAGGG - Intergenic
1026644816 7:72158427-72158449 TTGGAGAGGTGGAGTGGGGAAGG - Intronic
1027198010 7:76044529-76044551 GTGGAGATGAGGACTTGGGAGGG + Intronic
1028349851 7:89832664-89832686 GAGGAGAACTACAGTTGGAAAGG + Intergenic
1028636013 7:92989957-92989979 ATGGAGAGGTTGAGATGGGAGGG - Intergenic
1028959324 7:96731580-96731602 GTGGATAAATCGAGGTGGGAGGG + Intergenic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030537024 7:110780797-110780819 GTGGGGAAGTAGAGTAGCAAAGG - Intronic
1031837424 7:126695097-126695119 GAGGAGGAATAGAGATGGGAGGG + Intronic
1032320875 7:130885588-130885610 GCTGAGAAGTACAGATGGGAAGG + Intergenic
1032750781 7:134838692-134838714 GGGGAGAATTGTAGTTGGGAAGG - Intronic
1033469756 7:141634621-141634643 GTGGAGAGGTAAAGTAGGCAAGG + Intronic
1033639448 7:143247109-143247131 GTGGAGAGGAAGTGATGGGATGG - Intronic
1034080039 7:148268218-148268240 GTGGTGATGTACAGGTGGGAGGG + Intronic
1034214699 7:149396381-149396403 GTGAAGAAGACGAGTAGGGAAGG + Intergenic
1035766963 8:2113973-2113995 GTGGATAGGTAGGGTGGGGAGGG + Intronic
1036961416 8:13248719-13248741 GTGGAGAGGGAGACATGGGATGG - Intronic
1037920271 8:22800978-22801000 GTGGAGTGGCAGAGTTGGGTGGG - Intronic
1038863758 8:31416049-31416071 TTGTAGAAGCATAGTTGGGAAGG + Intergenic
1038996629 8:32930289-32930311 CCAGAGAAGTAAAGTTGGGAAGG - Intergenic
1039597001 8:38799137-38799159 GTGGGGGAGGAGAGCTGGGAGGG + Intronic
1041388740 8:57330502-57330524 ATTGTGAAGGAGAGTTGGGAAGG - Intergenic
1041713497 8:60913615-60913637 GGGGAGAAATAGAGTGGAGAAGG + Intergenic
1041788285 8:61660288-61660310 GGGGAGAAGTAGGAATGGGATGG + Intronic
1046583715 8:116124953-116124975 GTGAGGAAGTTGAGTTTGGAAGG - Intergenic
1046726130 8:117675905-117675927 GGGGAAAAGAAGAGGTGGGATGG + Intergenic
1047732377 8:127737702-127737724 GTGGAGAGGGAAGGTTGGGAGGG + Intronic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049512690 8:143037721-143037743 GTCAAGAGGTACAGTTGGGAAGG + Intergenic
1050178010 9:2889527-2889549 GTGGATTACTAGAGTGGGGAGGG + Intergenic
1051207147 9:14700046-14700068 GGGGAGAAATAGAGCTGGGGTGG - Intergenic
1056507482 9:87270901-87270923 GTGGGGATGAAGAGTTTGGAGGG + Intergenic
1056938612 9:90936855-90936877 CTAGAGAAGTAGTGATGGGAAGG + Intergenic
1057739784 9:97701223-97701245 GTGGAGAAGGAAGGTTGGGATGG - Intergenic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058056687 9:100455932-100455954 GTGGAGAAACAGCGCTGGGAAGG - Intronic
1058762554 9:108149266-108149288 GAGGAGGAGGAGACTTGGGAAGG - Intergenic
1058880990 9:109285861-109285883 GGGCAGGAGTAGAGTTGGGGAGG - Intronic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059458021 9:114412029-114412051 GTGGAGGTGGAGGGTTGGGAGGG + Intronic
1059734980 9:117091679-117091701 GGGGAGAGGTGGAGTGGGGAGGG + Intronic
1060704673 9:125787367-125787389 GTGATGAAGTAGAGTTTGAAGGG + Intronic
1061069593 9:128301056-128301078 GTGGAGACTTAGAGGTGAGAGGG + Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1062146959 9:134994864-134994886 GGGGGGAAGGAGAGGTGGGAGGG - Intergenic
1062185014 9:135213472-135213494 GTGAAGAACAAGAGTTGGAAGGG + Intergenic
1187402493 X:18974212-18974234 GTGGAGATATGGGGTTGGGAGGG - Intronic
1187505305 X:19874419-19874441 GAGGAGAGGAAGAGTTGGGGGGG + Intronic
1188701452 X:33269425-33269447 GTGGACTACTAGAGTGGGGAGGG + Intronic
1190036444 X:47029398-47029420 GTGGCAGAGTAGAGTAGGGAAGG + Intronic
1190913555 X:54793414-54793436 GAGGAGGAGCAGATTTGGGAGGG - Intronic
1191851286 X:65588084-65588106 GTGGGGAATTAGAGTGGGGCTGG + Intergenic
1195670782 X:107468102-107468124 GGGGAGAAGTAGAGTAGGGGTGG - Intergenic
1196059981 X:111397887-111397909 GTGGTTAAGTAGGATTGGGATGG + Intronic
1198532440 X:137559763-137559785 GAGGGGCAGTTGAGTTGGGAGGG + Intergenic
1199868110 X:151872500-151872522 GAGGAGCAGTAGAGTAAGGAGGG + Intergenic
1200016142 X:153165038-153165060 GGAGAGAAGGAGAGTGGGGAGGG + Intergenic
1200184956 X:154176150-154176172 GTGGAGAAGGCCAGTCGGGATGG - Intergenic
1200190609 X:154213288-154213310 GTGGAGAAGGCCAGTCGGGATGG - Intergenic
1200196360 X:154251090-154251112 GTGGAGAAGGCCAGTCGGGATGG - Intergenic
1200202015 X:154288208-154288230 GTGGAGAAGGCCAGTCGGGATGG - Exonic
1200247277 X:154532941-154532963 GTGGAGAATGAGAGGTGGGATGG - Exonic
1200381093 X:155838061-155838083 GTGGACTACTAGAGGTGGGAGGG + Intergenic
1201465196 Y:14273077-14273099 GTGGAGGATTAGACTTGGGAGGG - Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic