ID: 1097669172

View in Genome Browser
Species Human (GRCh38)
Location 12:62515570-62515592
Sequence CTTTGTAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120220
Summary {0: 1, 1: 79, 2: 2655, 3: 30187, 4: 87298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097669164_1097669172 12 Left 1097669164 12:62515535-62515557 CCCAGGTGCAGTGGTGCATGCCT 0: 3
1: 13
2: 166
3: 712
4: 2045
Right 1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG 0: 1
1: 79
2: 2655
3: 30187
4: 87298
1097669166_1097669172 -8 Left 1097669166 12:62515555-62515577 CCTGTAATCCCAGCACTTTGTAA 0: 67
1: 12455
2: 313856
3: 264775
4: 144378
Right 1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG 0: 1
1: 79
2: 2655
3: 30187
4: 87298
1097669165_1097669172 11 Left 1097669165 12:62515536-62515558 CCAGGTGCAGTGGTGCATGCCTG 0: 62
1: 896
2: 12968
3: 44349
4: 109836
Right 1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG 0: 1
1: 79
2: 2655
3: 30187
4: 87298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097669172 Original CRISPR CTTTGTAAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr