ID: 1097671654

View in Genome Browser
Species Human (GRCh38)
Location 12:62546668-62546690
Sequence CACTTGAACCAAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181667
Summary {0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097671649_1097671654 8 Left 1097671649 12:62546637-62546659 CCAGCTACTCAGGAGACTGAAGC 0: 160
1: 7521
2: 103504
3: 207967
4: 232352
Right 1097671654 12:62546668-62546690 CACTTGAACCAAGGAGACGGAGG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
1097671648_1097671654 9 Left 1097671648 12:62546636-62546658 CCCAGCTACTCAGGAGACTGAAG 0: 238
1: 9790
2: 118148
3: 220290
4: 240421
Right 1097671654 12:62546668-62546690 CACTTGAACCAAGGAGACGGAGG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
1097671647_1097671654 17 Left 1097671647 12:62546628-62546650 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 1097671654 12:62546668-62546690 CACTTGAACCAAGGAGACGGAGG 0: 5
1: 470
2: 10453
3: 51683
4: 119056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097671654 Original CRISPR CACTTGAACCAAGGAGACGG AGG Intronic
Too many off-targets to display for this crispr