ID: 1097675816

View in Genome Browser
Species Human (GRCh38)
Location 12:62602292-62602314
Sequence CAAAAGCAGAAGTGGCTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097675812_1097675816 -5 Left 1097675812 12:62602274-62602296 CCCGTAAGTTGTCTGGGCCAAAA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1097675816 12:62602292-62602314 CAAAAGCAGAAGTGGCTCCATGG 0: 1
1: 0
2: 2
3: 32
4: 246
1097675813_1097675816 -6 Left 1097675813 12:62602275-62602297 CCGTAAGTTGTCTGGGCCAAAAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1097675816 12:62602292-62602314 CAAAAGCAGAAGTGGCTCCATGG 0: 1
1: 0
2: 2
3: 32
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097675816 Original CRISPR CAAAAGCAGAAGTGGCTCCA TGG Exonic
900992545 1:6104587-6104609 CCAACGCAGCAGTGGCTCCGAGG + Exonic
902560876 1:17276825-17276847 GAAAAGCAGAAGTGTGGCCACGG + Exonic
902999003 1:20251068-20251090 CAACAGCAGAAGTTGCTCTCTGG + Intergenic
904094334 1:27965837-27965859 CAGAAGCACAAGGGCCTCCAGGG - Intronic
904498511 1:30901031-30901053 CAAGATCAGATGGGGCTCCAGGG + Intronic
905003613 1:34693199-34693221 CCAACACAGATGTGGCTCCAAGG + Intergenic
905743952 1:40397447-40397469 CAAAAGCAGAACTGGCACCAAGG - Intronic
905876077 1:41432872-41432894 CAGCAGCAGAAATGGCCCCATGG - Intergenic
908298323 1:62735749-62735771 CAGAAGTAGAGCTGGCTCCAGGG + Intergenic
908627294 1:66058838-66058860 CAATGGAAGAAATGGCTCCAGGG - Intronic
911476406 1:98378822-98378844 CCAAAGCAGAAATGCCCCCATGG - Intergenic
912333082 1:108836897-108836919 AAAATGCAGAAGTGGATTCATGG + Intronic
912566920 1:110594092-110594114 CAATAGCAGAAGGAACTCCAAGG - Intronic
913581031 1:120227017-120227039 CAAAATAAGAAATGGCTTCAGGG - Intergenic
913627145 1:120671383-120671405 CAAAATAAGAAATGGCTCCAGGG + Intergenic
914562961 1:148838454-148838476 CAAAATAAGAAATGGCTTCAGGG - Intronic
914609866 1:149291768-149291790 CAAAATAAGAAATGGCTTCAGGG + Intergenic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
916087995 1:161285118-161285140 CAGAAGCATAAGAGGTTCCAGGG + Exonic
919215298 1:194545774-194545796 CAAAAGCAAAAGTGGATAAATGG - Intergenic
920230620 1:204467354-204467376 CAAAAGCAGAATCAGCTCCTGGG - Intronic
921439369 1:215166385-215166407 TAAAAGCAGAAATGGGTCCAAGG + Intronic
921897943 1:220420657-220420679 CCAGAGCAGAAGTGGGGCCACGG - Intergenic
923460012 1:234201110-234201132 CAAATGCAGGAGAGGCCCCATGG + Intronic
1062869810 10:890665-890687 CAAAATCACAATTTGCTCCAGGG - Intronic
1063425331 10:5946049-5946071 TAAAGGCAGAAATGGCTCCAAGG - Intronic
1064377520 10:14810385-14810407 CAAAAGCTGATGTGGATTCACGG + Intergenic
1067663830 10:48256575-48256597 CCAATGCAGGAGTGTCTCCAGGG - Intronic
1068068898 10:52170482-52170504 CAAAAACATTAGTGGCTGCAGGG + Intronic
1068821711 10:61384495-61384517 GTAAAGGAGAAATGGCTCCAAGG - Intergenic
1069009959 10:63361520-63361542 AAAAAGCAGAAGTGTCTCTGGGG + Intronic
1071363996 10:84880160-84880182 CAAAAACTCAAATGGCTCCAGGG + Intergenic
1071521901 10:86336713-86336735 CATAACCAGACCTGGCTCCATGG + Intronic
1073112597 10:101071527-101071549 AAAAAGCAGAACTGGCTGCGTGG - Intergenic
1073891915 10:108112220-108112242 TAAAAGAACAAGTGGCTCCCTGG + Intergenic
1074849750 10:117430195-117430217 ATAAAACACAAGTGGCTCCATGG - Intergenic
1075578511 10:123598276-123598298 CAGATGCAGGAGTGGCTCCCAGG - Intergenic
1076198563 10:128539953-128539975 CAAAAGCAGAACTGGTCCCCAGG + Intergenic
1078153104 11:8775675-8775697 TTAAAGAAGAAATGGCTCCAAGG - Intronic
1078629596 11:12990175-12990197 CAGGAGCAGAAGTGGGGCCATGG - Intergenic
1079466358 11:20734855-20734877 CAACAGCAGCAGTGGCCCCTGGG + Intronic
1080843386 11:36005044-36005066 CAACAGGAGAAATGTCTCCAGGG - Intronic
1080990033 11:37521143-37521165 CAAAAGCAAAAGTGGACCAATGG + Intergenic
1083864115 11:65444500-65444522 CACTAGCAGGAGGGGCTCCAGGG + Intergenic
1085184378 11:74562996-74563018 CAAAAAAAGTAGTGGCTCCTAGG + Intronic
1089083353 11:115796179-115796201 CAAAAGCAGGATTGGCCCCATGG + Intergenic
1090115635 11:123969288-123969310 CAAAAGCAGAAATGGATAAATGG - Intergenic
1092560008 12:9602850-9602872 TAAAAGTAGAAATGGCTTCATGG - Intronic
1094389838 12:29936950-29936972 CAAAACCAGAAGAGTCTTCAAGG - Intergenic
1094630384 12:32168394-32168416 CAAAAGCAGATGAGGGTCCAGGG + Intronic
1095995291 12:48077279-48077301 CAAAAGCAGAAGTAGGCACATGG - Intronic
1096353520 12:50919540-50919562 TAAAAACAGAAAAGGCTCCATGG + Intergenic
1096603139 12:52744791-52744813 CAGAAGCACAAGTCTCTCCATGG - Intergenic
1097675816 12:62602292-62602314 CAAAAGCAGAAGTGGCTCCATGG + Exonic
1098179655 12:67832662-67832684 CAATAGCAGTAGGGCCTCCAGGG + Intergenic
1098991944 12:77073321-77073343 AAATAGCAGAAGTGGCCACATGG - Intergenic
1099269336 12:80487617-80487639 CTAAGTCAGAAGTGACTCCAAGG - Intronic
1099349338 12:81545586-81545608 CAAAAATAGAAGTTGCACCATGG + Intronic
1099529745 12:83763214-83763236 GAAAAGCAGCAGCGGCTGCAGGG + Intergenic
1100151816 12:91747176-91747198 CAAAGGCAGGAGTGTCTCCATGG - Intergenic
1100577058 12:95901994-95902016 CAAAAACTGAAGTGGTTTCATGG - Intronic
1100577206 12:95904258-95904280 CAAAAACTGAAGTGGCTTCATGG - Intronic
1101129201 12:101671610-101671632 TAAAACCAGAAGTGGCAACAAGG + Intronic
1102434765 12:112912605-112912627 CAAAAGCAGCACTGCCCCCAGGG + Intronic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1107373258 13:39775073-39775095 CAAAAGCAGAACTTCCTCCAAGG - Intronic
1107706271 13:43109583-43109605 CAAAACCAGATCTGACTCCAAGG - Exonic
1107740565 13:43445764-43445786 CAAAAGCAAAAGAGCCTCCTGGG + Intronic
1108138228 13:47388532-47388554 CAAAAGCCACAGTGGCTGCATGG + Intergenic
1109757168 13:66775985-66776007 CAAAAGCAGAAGCAGTTGCATGG - Intronic
1111551199 13:89815451-89815473 CAAAATCAGAAGTGTTTCTAAGG + Intergenic
1111715556 13:91875293-91875315 CAAAAGCAGAAGTTACTACACGG - Intronic
1112193616 13:97202960-97202982 CAAAACAAGAAGTGGAGCCAAGG - Intergenic
1113194794 13:107789730-107789752 CAAAATCAGAACTGGCACCCAGG + Intronic
1113382766 13:109818657-109818679 CACAAGCAGAGGTGCCACCAGGG + Intergenic
1115410535 14:33068952-33068974 CAAAAGCCGAAGTCCCTCCCTGG - Intronic
1115420775 14:33192529-33192551 CATAAGAAGAAGGGGTTCCAAGG - Intronic
1116087567 14:40260192-40260214 CAATTGCAGAAGTTGCTCCCAGG + Intergenic
1116654079 14:47629008-47629030 GAAAAGCAGGAGTGGGTACAGGG - Intronic
1117664159 14:58039003-58039025 CAAATGTGGTAGTGGCTCCAGGG - Intronic
1118069112 14:62225748-62225770 CAGAAGCAAAAATGGCTCCCAGG - Intergenic
1119465820 14:74857446-74857468 CAAAATCAGAGGTTGCTTCAGGG + Intronic
1119940773 14:78638931-78638953 CAAAAGAAGTAATGGCTCCAAGG - Intronic
1122480293 14:102042809-102042831 CAAATGCAGAAGTGGGTCCCTGG + Intronic
1122597163 14:102901835-102901857 CAAAAGGAGAAGTGAATTCAGGG + Intronic
1124021895 15:25933040-25933062 CGAAAGCAAATGTGGCTCCCAGG + Intergenic
1124119672 15:26878021-26878043 GAAAAGCAGAAGTGGCGCGTCGG + Intronic
1124396350 15:29305409-29305431 CAAAGGCAGGAGTAGCGCCAGGG + Intronic
1124443932 15:29711665-29711687 CAAAATCAGAAGTGGGTCTAGGG - Intronic
1125338479 15:38651664-38651686 CAAAAGCAGAAAAGGGCCCAGGG + Intergenic
1126344002 15:47674090-47674112 CAAAACCAGCACTGGCTCCTGGG + Intronic
1127612164 15:60647512-60647534 CAAAAGCACAACTGGTCCCAAGG + Intronic
1129309350 15:74695372-74695394 CAAAGGCAGAAATGAATCCAGGG + Intronic
1129604668 15:77019054-77019076 CAAAGGAAGAAGTGGGCCCATGG + Intronic
1129680327 15:77655270-77655292 CCAAAGCAGAACTGGCCCCGTGG - Intronic
1129936819 15:79457728-79457750 CATGAGCATCAGTGGCTCCACGG + Exonic
1131074904 15:89489499-89489521 CAAAAGGAAAAGAGACTCCAGGG + Intronic
1131842245 15:96449852-96449874 CAGAAGCCATAGTGGCTCCAAGG - Intergenic
1132475794 16:137345-137367 CAAAGGCAGACGGAGCTCCAAGG + Intronic
1133183890 16:4081334-4081356 CAGAACCAGCAGTGGCTCCATGG + Intronic
1134451641 16:14367557-14367579 GAACAGCAGCAGGGGCTCCAGGG + Intergenic
1135650104 16:24198487-24198509 AAAAAGCAGAAAAGACTCCAAGG - Intronic
1136032078 16:27510688-27510710 CAGAAGGTGAAGTGGCTGCAAGG - Intronic
1137697228 16:50469405-50469427 CAAAAGCAGAGATGGTTCTAGGG + Intergenic
1138732764 16:59214099-59214121 CAAAAGCAGAAGTGACAGCCCGG - Intergenic
1138738558 16:59280548-59280570 CTATAGCAGAAGTGGCTCTTGGG - Intergenic
1141025267 16:80540971-80540993 CAAAAAAGGAAGTGGCCCCACGG - Exonic
1142766919 17:2070031-2070053 TAAAAGCAGAAGAGTCTCCTTGG + Intronic
1144993590 17:19250880-19250902 CAGAGGCAGAAGAGGCTTCAGGG - Intronic
1145802726 17:27700040-27700062 CAAAAGCAGAAGTGGAAAAATGG + Intergenic
1145937845 17:28725738-28725760 CAAAAGCCGCAGTGGCCCCAGGG - Intronic
1146916168 17:36679819-36679841 CAAAAGCAGAGCTGGCCTCAGGG + Intergenic
1149529241 17:57381410-57381432 AGAAAGCAGAAGAGGCTTCAAGG - Intronic
1150635372 17:66909481-66909503 CTAAAGCAGAAGAGACTCCCAGG - Intergenic
1152479811 17:80543153-80543175 CAATAGGAGAATTGGCTCCATGG + Intergenic
1153166012 18:2262990-2263012 GCAAAGCACAAGTGGCACCATGG + Intergenic
1155160507 18:23191584-23191606 CAGAAGAACAAATGGCTCCAAGG + Intronic
1156535860 18:37863809-37863831 GAAAAGCAGAAATGGATGCAGGG + Intergenic
1156856344 18:41785874-41785896 ATAATGCAGAAGTCGCTCCATGG - Intergenic
1158643614 18:59223331-59223353 CAAAAGCAAAACTGGACCCAGGG + Intronic
1159309557 18:66689075-66689097 GAAAAACAGAAAAGGCTCCATGG + Intergenic
1159965552 18:74592166-74592188 GAAAAGGAGAAATGGATCCAGGG - Intergenic
1160478980 18:79220914-79220936 CAAAAGCACAAGAGGCCCAAAGG - Intronic
1161887211 19:7006064-7006086 CGGAGGCAGAAGTGGTTCCAAGG + Intergenic
1162252639 19:9459325-9459347 CAAAGGCAGAAGTGGAACAATGG + Intergenic
1163587913 19:18173846-18173868 GAACAGCAGAAGTGGCGACAGGG - Exonic
1167526633 19:49988360-49988382 CAAAAACAGAAGTGAGTCTAGGG - Exonic
1167736434 19:51297152-51297174 CAAAGCCTGAAGTGGCTGCAGGG - Intergenic
1168378678 19:55901900-55901922 CAAAACCAGAAGCTCCTCCATGG + Intronic
925019802 2:559339-559361 CAAAACCAGGAGAGGCTCCATGG + Intergenic
926041421 2:9676270-9676292 TAAAAGAAGAACTGGCACCAGGG - Intergenic
926760301 2:16272619-16272641 CAAAAGCAGAACAGGCAGCATGG - Intergenic
928704979 2:33939934-33939956 AAAAAGCAGAAGAGCCTCAAGGG - Intergenic
929380985 2:41353611-41353633 CAAATGCAGAAGTGCCCTCATGG + Intergenic
929386957 2:41420463-41420485 TAAAAGCAGAAGTGACTCCAAGG - Intergenic
931018087 2:58009358-58009380 AGAAAGTAGAAGAGGCTCCATGG - Intronic
932663690 2:73679413-73679435 GGAAAGCAGAAGTGGCTGCTTGG - Intergenic
932878391 2:75476404-75476426 CATAAGAAGAGGTGACTCCATGG - Intronic
933729220 2:85444726-85444748 CAAAAGCACAACAGGCACCAGGG + Intergenic
933768239 2:85725690-85725712 CAAAAGCAGAACAAGCTCCAGGG + Intergenic
935243794 2:101200862-101200884 CATAAGCAGGAGAGGTTCCAAGG + Intronic
937071587 2:119067625-119067647 CAGAAGCAGAAATGGCTTCATGG - Intergenic
938482723 2:131674629-131674651 AAAAATCAGGAGAGGCTCCATGG + Intergenic
938824594 2:134992483-134992505 CAAAAGCTCCAGTGTCTCCAGGG + Intronic
940237558 2:151527286-151527308 CCAAAGGAGAATAGGCTCCATGG + Intronic
941595037 2:167466176-167466198 CAAAAACAAAAATGGCTCCCAGG - Intergenic
942166431 2:173245367-173245389 CATAATCAGGAGTGGCTGCAGGG + Intronic
942798335 2:179847608-179847630 CAAAACCAAAAGTGGCTGCAAGG - Intronic
946687228 2:222282583-222282605 CAAAAGAAAAATTGTCTCCAAGG - Intronic
947078769 2:226372241-226372263 TAAAAGCAGAATTGGTCCCATGG - Intergenic
948470932 2:238178330-238178352 CACCACCAGAACTGGCTCCATGG + Intronic
1171796159 20:29568029-29568051 CCAAGGCAGAAGTGTCTCCCTGG - Intergenic
1172107793 20:32527172-32527194 GAGAAGCAGAAATGTCTCCAAGG - Intronic
1172814941 20:37678794-37678816 AAAAAGCAAAAGTCACTCCAAGG - Intergenic
1174590993 20:51644948-51644970 CAGAACCAGAAGTGGCTTCCAGG + Intronic
1174785142 20:53425383-53425405 CAAAAGCATGAGAGGGTCCAAGG + Intronic
1175426848 20:58872968-58872990 CAAAGGCAGAAGTGGCTTCCTGG + Intronic
1175856584 20:62123642-62123664 CTTAGGCAGACGTGGCTCCACGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178982194 21:37273934-37273956 GAAGAGCAGAAGTAGCTCCTGGG + Intergenic
1180229677 21:46419580-46419602 GAAAAACAAAAGTGGCTCGAGGG - Intronic
1181389858 22:22572387-22572409 CAAAAGATGAAGTGGCAGCAAGG + Intergenic
1181759479 22:25048359-25048381 CAAAAGGAGAAATGGCTCTGCGG + Intronic
1182933187 22:34194453-34194475 CCAAAGAAAAAATGGCTCCATGG + Intergenic
1183230722 22:36580316-36580338 CAACAGCAGGAGTGGAACCAAGG - Intronic
1183581944 22:38731509-38731531 CAAACGCAGGATTGTCTCCAAGG - Exonic
1184219770 22:43092246-43092268 CAAAAGAAGAAGTGGTTCAAAGG + Intergenic
1184581444 22:45420585-45420607 CAGATGCAGAAGAGGATCCAGGG - Intronic
1184641959 22:45877601-45877623 GAAAAGCAGCAGAAGCTCCATGG - Intergenic
1185214024 22:49588201-49588223 CAAAAACAGAGGTGGCTGGAGGG + Intronic
949376222 3:3393053-3393075 CAACAGCAGAGGTGGCCCCAGGG - Intergenic
950410445 3:12832914-12832936 CCAAAGCACATCTGGCTCCAGGG + Intronic
950745481 3:15084691-15084713 CAAAAGAAGATGAGGGTCCAGGG + Intronic
952254307 3:31682295-31682317 CAAAAGCACCAGTGGCTTCAGGG + Intronic
953763908 3:45718064-45718086 AATAAGCAGAAATGGCTCTAAGG - Intronic
954305685 3:49724143-49724165 CAAAGGCGGAACTGGCGCCAAGG + Intergenic
954975999 3:54695456-54695478 CAAATGCATGAGTGGTTCCAAGG + Intronic
955700907 3:61681106-61681128 CAGAGACAGAAATGGCTCCAGGG - Intronic
956186663 3:66569344-66569366 CTAAGGCAGAAGTGGCAACATGG + Intergenic
957929913 3:86864138-86864160 CTGAAGCAGAAGTGGCCCCTAGG + Intergenic
959913990 3:111795641-111795663 CAAAAGGAGGAGGAGCTCCAAGG - Intronic
961069602 3:123909999-123910021 TAAAAGCAGACCTGGCTTCAAGG + Intronic
966154322 3:176899566-176899588 TAAAAGCTAAAGTGGCTTCAGGG + Intergenic
966646639 3:182252884-182252906 CAAAAGCACAAGAGAATCCAAGG - Intergenic
966749339 3:183306942-183306964 TAAAAGCAGAACTTGCTGCAGGG - Intronic
967131637 3:186476356-186476378 CACAAGCAGGGGTGGCTTCATGG - Intergenic
967974609 3:195026153-195026175 CAAAAACAGAGGGAGCTCCAAGG + Intergenic
968644543 4:1733246-1733268 TAAAAACATAAGTGGCTCAATGG - Intronic
969088671 4:4675794-4675816 CAAAAGCAGGGGAGGCTCCTTGG - Intergenic
973536781 4:51890950-51890972 CAAAAGCACAGGTGGCACCTGGG + Intronic
974888587 4:67851463-67851485 GCAAAGCACCAGTGGCTCCAGGG - Intronic
974986255 4:69029600-69029622 CAAAAGCAGTAGTTGGTACAAGG + Intronic
975021373 4:69494329-69494351 CAAAAGCAGTAGTAGGTACAAGG - Intronic
976700609 4:87965905-87965927 CCAAGGCAGAACTGGGTCCAGGG + Intergenic
977296239 4:95212723-95212745 GAGAAGCAGCAGTGGCTCCAGGG - Intronic
979061384 4:116066568-116066590 CAAAATCAGGAGTAGCTCCTTGG - Intergenic
979988157 4:127340795-127340817 TAAAACCACAAGTGCCTCCAGGG + Intergenic
982241236 4:153301501-153301523 CAAAAGCAAAAATGGATACATGG - Intronic
984919586 4:184751640-184751662 CAAAAGAAGTAGTGGGTGCAAGG - Intergenic
985575505 5:671776-671798 CAAAGACAGAACTGGCCCCAGGG + Intronic
986680569 5:10229438-10229460 CAAGAGCAGAAGGGCCTCCTGGG - Intronic
987055543 5:14187313-14187335 GAAAAGCAGAAGTTGCTAGATGG + Intronic
990448635 5:55915924-55915946 GAAAATCAGAAGTGGCCTCATGG - Intronic
990879165 5:60520632-60520654 CCAAAGCAGAAGTGGCTGGGTGG - Intronic
991435330 5:66592364-66592386 CAAAAGCTTGAGAGGCTCCACGG + Intergenic
991919460 5:71640748-71640770 GAAAAGCAGGAAAGGCTCCAAGG - Intronic
996087197 5:119317120-119317142 CAGACGCAGAAGAGGCTCAAAGG - Intronic
997244088 5:132331365-132331387 AAAAAGCAGACGTGGCCTCAAGG + Intronic
997748809 5:136325030-136325052 CAAAAGCAGAAATATCTCCCAGG - Intronic
997827767 5:137122978-137123000 ATGAAGCAGAAGTGGCTTCAGGG + Intronic
998416556 5:141950351-141950373 CAGCAGCAGAAATGGCTACAGGG - Intronic
1000914343 5:167062033-167062055 CTAAAGTAAAAGTGGCTTCATGG + Intergenic
1001941941 5:175746661-175746683 CAGAGGTAGAGGTGGCTCCAGGG - Intergenic
1005013379 6:21356708-21356730 CAAGTACAGAAGTGGCTCCAGGG + Intergenic
1005032587 6:21525215-21525237 CAAAAATAGAAGTGCCTCTAAGG - Intergenic
1006524255 6:34590313-34590335 CAAAACCCAAAGTGGCTGCATGG + Exonic
1006815259 6:36845597-36845619 GAAAAGCAGGAGTGGCTGGAAGG - Intergenic
1007908600 6:45489877-45489899 CATAAGCAGAAGTAGCAACAAGG - Intronic
1009577920 6:65491131-65491153 CAAAAGCAGAAATGGCTGCCTGG + Intronic
1011701442 6:89958893-89958915 CAAAACCAGAACTGGCTAGATGG + Intronic
1011716361 6:90109301-90109323 CACAAGAAGAAGTGGTTTCATGG - Intronic
1012141564 6:95632119-95632141 CCAAAACAAAAGTGGCTACATGG - Intergenic
1012594694 6:101025480-101025502 GAAAAGCAGAAAAGGCCCCATGG + Intergenic
1012855918 6:104501545-104501567 TAAAAGCAGTATAGGCTCCAAGG + Intergenic
1017211876 6:151866027-151866049 CAAAAGCAGGAGTGGTTTTAAGG - Intronic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1018303898 6:162433564-162433586 CAAAATGAGAATTGACTCCAAGG + Intronic
1018504710 6:164452532-164452554 CAAAAGAAGAACTGGTTACAAGG + Intergenic
1019214733 6:170435871-170435893 GGAAAGCACAAGTGACTCCAAGG + Intergenic
1020218509 7:6215225-6215247 CAAGAGCAGAAGATGCTCCACGG + Intronic
1020286883 7:6689185-6689207 CCAAAGGAGGAGTGGCTACAAGG + Exonic
1021040444 7:15855718-15855740 GAAAACCAGATGGGGCTCCAGGG - Intergenic
1021902883 7:25304995-25305017 CAAAAGCAAAAGGGACTTCAGGG - Intergenic
1023792452 7:43763592-43763614 CAAAAGCAGTAGTGGCCCACGGG - Intronic
1024013132 7:45287663-45287685 CAGAAGTACAGGTGGCTCCAGGG - Intergenic
1027046862 7:74996656-74996678 CAAAACCAGAAATGGATGCATGG + Intronic
1029187196 7:98747723-98747745 CAAAGGCAGATGTGGGCCCAAGG + Intergenic
1030837955 7:114311878-114311900 CAAAAACAAAAGAGGTTCCAGGG - Intronic
1032000410 7:128261546-128261568 CACACACAGAACTGGCTCCAGGG + Intergenic
1032467178 7:132153446-132153468 CCAAAGCAGAAGTGGCAGCGAGG + Intronic
1032735731 7:134691187-134691209 CCAAAACAGCAGTGCCTCCATGG - Intergenic
1035201254 7:157268176-157268198 CATAAGCAGCAGCGGCCCCATGG - Exonic
1036200899 8:6771074-6771096 CAAAAGCAGAACTGGGTCCTAGG + Intergenic
1038131955 8:24742362-24742384 CAAAACCTGAAGTGGTTACAAGG + Intergenic
1038343331 8:26708103-26708125 AACAAGCAGAAGAGGCTCCTGGG + Intergenic
1038724329 8:30066880-30066902 CAAAACCAGAAGTTGCACCATGG + Exonic
1040905124 8:52461044-52461066 GAAAAGGAGAAGTTGCTACAGGG - Intergenic
1041349333 8:56932974-56932996 CATTAGCAGAAGCGGCTCCATGG - Intergenic
1041430118 8:57771436-57771458 CAAAACAAGAATTGGCTCTAGGG + Intergenic
1042106391 8:65331981-65332003 AAACAGCAGAAGTTGCTACAAGG + Intergenic
1043513609 8:80975879-80975901 CAAAGACAGAAGAGACTCCAGGG + Exonic
1043567769 8:81567788-81567810 TAAAAGCAGAAGTGGATAAATGG + Intergenic
1043743999 8:83850751-83850773 CAAATGCACAGGTTGCTCCAAGG + Intergenic
1044089512 8:87981611-87981633 CAAAGCCAGAACTGGCTACATGG + Intergenic
1045000616 8:97875008-97875030 CAAAAGTAGAAGAGGGGCCAGGG - Intronic
1045168336 8:99632658-99632680 GAAAAGAAGAATTGGCTGCAGGG + Intronic
1045342082 8:101264077-101264099 CAAAAGAAGAGGTGGTTACACGG + Intergenic
1046457563 8:114486859-114486881 AAAAAGCAGAAGTGATTCAAAGG - Intergenic
1047026399 8:120829170-120829192 CAAAGGCAGAAGAAGTTCCATGG - Intergenic
1047304231 8:123640130-123640152 CATAAGCAGTGGTGGCTCCTAGG - Intergenic
1047401391 8:124551186-124551208 CAAAAGCAGAAATCGCTGCAAGG - Intronic
1048869371 8:138784476-138784498 CAAATGGGGAAGTGGCTCAAGGG - Intronic
1050704522 9:8382033-8382055 CAGAAGCAGAGGTGGCTGTAGGG - Intronic
1051663493 9:19446586-19446608 AAAAAGCTGAATTGACTCCAGGG + Intronic
1052658039 9:31390422-31390444 ACAAAGCAGAAATGGCTCAATGG + Intergenic
1052715086 9:32105978-32106000 CAAAAGCAAAAAAGTCTCCAAGG + Intergenic
1055585397 9:77754116-77754138 CAGAAGCAGCAGAGACTCCAGGG - Intronic
1057310735 9:93941326-93941348 CACAACTAGATGTGGCTCCAAGG + Intergenic
1057739324 9:97697944-97697966 CAAATGCAGGACTTGCTCCAAGG + Intergenic
1059599118 9:115756858-115756880 GAAAAGCTGCAGTGGCTCAAGGG + Intergenic
1060153678 9:121304290-121304312 CAAGGGCACAAGGGGCTCCAGGG - Intronic
1061892098 9:133627776-133627798 CAAAGGCACAACTGCCTCCATGG - Intergenic
1186498243 X:10029650-10029672 CAGAAGCAGAAGTGGAATCATGG - Intronic
1190426321 X:50337166-50337188 CAAAAGAAGAAGTGAAGCCATGG - Intronic
1190744481 X:53313938-53313960 CAAAGGCCAAAATGGCTCCAGGG + Intronic
1192150841 X:68711502-68711524 CAAAACCTGCAGGGGCTCCAGGG + Intronic
1193347082 X:80416138-80416160 CAAAATCAGAAATGACTACAGGG - Intronic
1195383907 X:104295870-104295892 GGACAGCAGAAGTGGCTCCTAGG + Intergenic
1197666718 X:129232107-129232129 CCAAAACACAATTGGCTCCAAGG + Intergenic
1200397024 X:155997115-155997137 AAAAAGCAAAAGTGTCTGCATGG + Intergenic
1201468547 Y:14310942-14310964 GAAAAGCAGAAGCTGCTCCCAGG - Intergenic