ID: 1097676119

View in Genome Browser
Species Human (GRCh38)
Location 12:62603648-62603670
Sequence GAGGCACGGGACCACGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097676119_1097676136 26 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676136 12:62603697-62603719 AGTAGTTTGTGCTGTTGGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 142
1097676119_1097676130 2 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676130 12:62603673-62603695 CGACACCATGGCCCTGGCTGAGG 0: 1
1: 0
2: 0
3: 20
4: 193
1097676119_1097676135 25 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676135 12:62603696-62603718 TAGTAGTTTGTGCTGTTGGTCGG 0: 1
1: 0
2: 0
3: 16
4: 141
1097676119_1097676134 21 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676134 12:62603692-62603714 GAGGTAGTAGTTTGTGCTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 111
1097676119_1097676126 -4 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676126 12:62603667-62603689 CCTCCCCGACACCATGGCCCTGG 0: 1
1: 0
2: 1
3: 31
4: 266
1097676119_1097676123 -10 Left 1097676119 12:62603648-62603670 CCCTCCGCGTGGTCCCGTGCCTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1097676123 12:62603661-62603683 CCCGTGCCTCCCCGACACCATGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097676119 Original CRISPR GAGGCACGGGACCACGCGGA GGG (reversed) Exonic
904294008 1:29505998-29506020 GAGGCACAGGAGCTCGGGGAGGG - Intergenic
917645725 1:177026835-177026857 GAGGCAGGGGAACAGGTGGATGG - Intronic
918952032 1:191151666-191151688 GAGGCACAGGAGCCCACGGAGGG - Intergenic
920364760 1:205442248-205442270 GAGGCACAGGGCTATGCGGAAGG + Intronic
923778916 1:237004415-237004437 GAGGCAGTGGAACACGTGGAGGG + Exonic
1074957686 10:118408360-118408382 GGGGCACGGGAACAAGCGCAGGG + Intergenic
1076472720 10:130729985-130730007 GAGGCATGGGACCAGGGGAAGGG - Intergenic
1076700499 10:132270367-132270389 GAAGCACGGGCCCACGCCGCTGG + Intronic
1077244026 11:1527240-1527262 TGGGCACGGGGCCACGCAGAGGG - Intergenic
1077367388 11:2166677-2166699 GGTGCACTGGAACACGCGGAAGG + Exonic
1077424338 11:2467297-2467319 GAGGCAGGGGCCCAGGAGGAGGG + Intronic
1079244794 11:18744154-18744176 GAGGCACTGGACGAGGCTGAAGG - Exonic
1085456976 11:76670832-76670854 GAGGCACGGGGCCAGGCGCTAGG - Intergenic
1089673670 11:120074410-120074432 GAAGCAAGGGACCAAGGGGATGG - Intergenic
1089781131 11:120874037-120874059 GAGGCCGGGGAGCAGGCGGAGGG - Intronic
1097676119 12:62603648-62603670 GAGGCACGGGACCACGCGGAGGG - Exonic
1121622835 14:95362022-95362044 GAGGCACTGGGGCACTCGGAAGG + Intergenic
1129324606 15:74793467-74793489 GAGGCACGGGGCTATGGGGAGGG + Intronic
1132566451 16:625706-625728 GAGCTACGGGGCCACCCGGAAGG + Intronic
1136552664 16:30989866-30989888 CAGGCCCGGGACCACCCGCAGGG + Exonic
1138391007 16:56669820-56669842 GAGGCAGTGGAACACGTGGAGGG - Exonic
1139593570 16:67946085-67946107 GAGGCAAGGGACCAGGTGGGCGG + Intronic
1142393197 16:89816192-89816214 GAGGCAGGGGAGCCCGGGGACGG + Intronic
1143344746 17:6241435-6241457 AAGGCAAGGGACCAAGTGGAAGG - Intergenic
1147836389 17:43335142-43335164 GAAGCACAGCACCACGGGGAGGG + Intergenic
1148686976 17:49506563-49506585 CAGGCACGGGTCCACGTGGTTGG - Exonic
1151464211 17:74274204-74274226 GACGCGCGGGGCGACGCGGAAGG - Intergenic
1152743779 17:82030110-82030132 CAGGCACGGGACGAGGCGCAGGG + Exonic
1162379578 19:10323472-10323494 GAGGCACAGCAGCAGGCGGACGG - Exonic
1165057968 19:33190743-33190765 GAGGCAAGGGACCACATGGAGGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
927130176 2:20051954-20051976 GAGACACGAGACAGCGCGGATGG + Exonic
927679694 2:25131568-25131590 GAGGCAAGGGACAACAGGGAGGG + Intronic
927904565 2:26847768-26847790 GAGGCACGGGTCCCCAGGGAGGG - Intronic
932761300 2:74440626-74440648 GAGGCCCGGGACCAGGGGGAGGG - Intronic
945430332 2:209755869-209755891 GAGGCCCGGGACCAGGCTCATGG - Intergenic
1174246792 20:49187989-49188011 GAGGCCCGGGAGAAGGCGGAGGG + Intronic
1175909884 20:62400151-62400173 GGGGCAGGGGACCAGCCGGATGG + Intronic
1179996423 21:44976488-44976510 GATGCACGTGGCCACGAGGAGGG + Intronic
1181094209 22:20495080-20495102 GAGGCACTCGGCCCCGCGGAGGG + Intronic
1183430479 22:37762742-37762764 CAGGCACGGGAGGAGGCGGATGG + Intronic
1183545891 22:38454822-38454844 GAGTCACGGGACCGCGCGCGCGG + Intronic
1184566172 22:45293399-45293421 GAGGCAGGGGACAGCCCGGAAGG + Intronic
952912488 3:38203022-38203044 GAAGCACAGCACCACGGGGAGGG - Intronic
954052938 3:47996466-47996488 GAGGCACGGGTACACAGGGAAGG + Intronic
954443449 3:50534191-50534213 GAGGCACAGGACCAGGCAGGAGG - Intergenic
955266982 3:57453856-57453878 GAGCCACGGCACCAGGCGCAAGG + Intronic
955656560 3:61251029-61251051 GAGGCACGGGGCCACGCCAGCGG - Intronic
964553467 3:157910596-157910618 GAGGCAGGGGACCAGGTGGTAGG + Intergenic
968508064 4:981204-981226 GAGGCGCGGGCCCACGTGCATGG + Intronic
971189772 4:24416397-24416419 GAGGCACGGGACCATGTGAGAGG + Intergenic
1001294506 5:170489513-170489535 GAGGCAGGGGACCAAGAGAAGGG - Intronic
1006132790 6:31878905-31878927 GAGGCCCGGGACCCTGTGGAGGG - Intronic
1019143365 6:169962029-169962051 GAGGGACGGGTCCTCGCGGTGGG + Intergenic
1019155984 6:170039305-170039327 GACGCAGGGGACCACCCTGATGG - Intergenic
1023986680 7:45101135-45101157 GAGGCCCGGGGCCACGGGCAGGG + Intronic
1024005084 7:45219486-45219508 GAGGCACAGGATCACACGCATGG - Intergenic
1027351296 7:77314449-77314471 GAGACACTGGACCCCGAGGATGG + Exonic
1032402048 7:131630327-131630349 GAGGAACGAGACCACGCGAGGGG - Intergenic
1034417855 7:150974644-150974666 GAGGGGCGGGACCACGGCGAGGG - Intronic
1034974847 7:155442015-155442037 GAGGCATGGGACCCAGGGGAGGG - Intergenic
1035304865 7:157925489-157925511 GGGACCCGGGACCACGAGGAAGG - Intronic
1035426719 7:158783026-158783048 GAGGCACGTGTCCATGGGGAAGG - Intronic
1049514187 8:143044730-143044752 GGGGCACGAGACCACGCTGCAGG + Exonic
1049710329 8:144060403-144060425 GAGGCACGGGAGTGCGGGGAGGG + Intronic
1056214302 9:84393390-84393412 CAGGCACAGGACCAGGCGCAGGG - Intergenic
1062021783 9:134322995-134323017 GAGGCAAGGGGCCACCCGGCAGG - Intronic
1192344626 X:70290662-70290684 AAGGCACGGGACAAGGCGTAAGG - Intronic