ID: 1097677379

View in Genome Browser
Species Human (GRCh38)
Location 12:62617340-62617362
Sequence AATTTTCTGCCTATTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097677379_1097677382 -6 Left 1097677379 12:62617340-62617362 CCCCATGGAATAGGCAGAAAATT 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1097677382 12:62617357-62617379 AAAATTTCAAGCACTTTTCTAGG 0: 1
1: 2
2: 4
3: 64
4: 546
1097677379_1097677384 19 Left 1097677379 12:62617340-62617362 CCCCATGGAATAGGCAGAAAATT 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1097677384 12:62617382-62617404 ACCTGAGTCTATTTTGAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097677379 Original CRISPR AATTTTCTGCCTATTCCATG GGG (reversed) Intergenic
904222084 1:28979978-28980000 AATTTTCTGCCAAATGCATTGGG - Intronic
906911507 1:49956748-49956770 ATTTGTCTCCTTATTCCATGAGG - Intronic
907245892 1:53108981-53109003 ACTTTTCTGCTTGTCCCATGAGG + Intronic
908479017 1:64518677-64518699 TACTTTCTTCCTATCCCATGAGG - Intronic
910120604 1:83785174-83785196 TATTTTTTGCAGATTCCATGTGG - Intergenic
910222634 1:84903649-84903671 ATTTCTCTACCTATTTCATGAGG + Intergenic
911622455 1:100080566-100080588 CATTTTCTACATATTCCATGTGG + Exonic
911667490 1:100570366-100570388 ATATTTCTGACTATTCAATGTGG - Intergenic
911749256 1:101477485-101477507 AATTTTCTTCCCATTGAATGTGG - Intergenic
912018047 1:105066858-105066880 ATTTTTATGCCAATACCATGTGG + Intergenic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
912536477 1:110376732-110376754 AATTTTATTCCTGTCCCATGTGG + Intronic
912658079 1:111505422-111505444 AATTCTCTGCACATACCATGGGG + Intronic
912871395 1:113310443-113310465 GATTTTCTCCCTGTGCCATGAGG - Intergenic
913712935 1:121504571-121504593 ATTTTTCTGCCTTTTTGATGTGG - Intergenic
914725980 1:150328219-150328241 CATTTTCTGGCTATTCCCAGGGG - Intronic
915878465 1:159639533-159639555 AATTTTGTGAATATTCCATGAGG + Intergenic
916500971 1:165386425-165386447 TATTTTCTGTCTCTTTCATGAGG - Intergenic
917485006 1:175447862-175447884 AATTATGTACCTATTCCTTGAGG + Intronic
919574315 1:199287973-199287995 AATTTTCAGCTTTTTCCATTTGG - Intergenic
919579975 1:199359232-199359254 ATATTGCTGCCTATTCCATGTGG + Intergenic
920052866 1:203174058-203174080 CATTTTCTGCCCATTTCCTGTGG - Intronic
920873543 1:209814003-209814025 AGTTTCCTGACTATCCCATGAGG - Intergenic
921127163 1:212188144-212188166 CATCTTCAGCCAATTCCATGTGG - Intergenic
921292732 1:213673663-213673685 AATTTTCTGCCTGTATTATGTGG + Intergenic
1063025305 10:2172580-2172602 AATTTTGTTCTTATTCCATATGG - Intergenic
1063073691 10:2692488-2692510 TATTTTCTGCCTCTTTCCTGTGG - Intergenic
1063169470 10:3494647-3494669 CTTTATCTGGCTATTCCATGGGG + Intergenic
1065177046 10:23087898-23087920 AATTGTCTGCCGAGCCCATGGGG - Intergenic
1066182511 10:32976999-32977021 AATTTTCTGCCCACCCCATTGGG - Intronic
1067524342 10:47029192-47029214 AATTTCCTGCTTCTTCCGTGAGG - Intergenic
1069066889 10:63950938-63950960 AATTTTTTGTCTATGGCATGAGG + Intergenic
1072570209 10:96651937-96651959 AATTTTCTTCCTGTTCATTGAGG - Intronic
1073736328 10:106351435-106351457 AATTTCCTACCTCTTCCTTGAGG + Intergenic
1075491919 10:122879056-122879078 GATCTACTTCCTATTCCATGGGG + Intronic
1076275404 10:129194491-129194513 ATTTTTCTTCTTCTTCCATGAGG + Intergenic
1076391139 10:130103294-130103316 AATTCTCTGCCTTTTCCTTTGGG + Intergenic
1077793828 11:5469937-5469959 AGTTCTCTGCCTTTTCCTTGTGG + Intronic
1078413551 11:11147364-11147386 AACTCTCTGCCTATTCCATCTGG - Intergenic
1078580715 11:12537470-12537492 AATTTTTTGCCTATAACATGGGG - Intergenic
1079148460 11:17875841-17875863 TATTTTGTGCCTTTTACATGTGG + Intronic
1079247441 11:18763082-18763104 AATTATTTGCCTCCTCCATGGGG - Intronic
1079665426 11:23099277-23099299 AAATTTCTGCCTTTTCCACTAGG - Intergenic
1080139556 11:28899611-28899633 AATTTTCTGATTTTTCCCTGGGG + Intergenic
1080207572 11:29748186-29748208 AATTTTCTGCTGAATCCAAGTGG + Intergenic
1080399364 11:31919963-31919985 AGTTTTCAGCCTCTTCCCTGGGG + Intronic
1080610690 11:33901241-33901263 AACTTCCTGCCTATTCCATCAGG - Intergenic
1082890308 11:58132053-58132075 AACTTTCTGACTATCCCAGGAGG + Intronic
1084143804 11:67252525-67252547 AATTTTTTGCCTATTCTGTGAGG + Intronic
1084330165 11:68425467-68425489 CATTTTCTGCCTCTGCCCTGTGG - Intronic
1085799510 11:79576067-79576089 AATGTTCTGGCTCTTCCTTGTGG + Intergenic
1087958581 11:104320298-104320320 AATGTTCTGCCTGATTCATGTGG - Intergenic
1088778691 11:113112729-113112751 CATTCTCTGCCTCTTCTATGTGG + Intronic
1090138203 11:124222811-124222833 AATTTTTAGCCATTTCCATGTGG + Intergenic
1093285503 12:17255058-17255080 AATTAGCTGCCCATGCCATGAGG - Intergenic
1095537231 12:43264453-43264475 ACTTTCCTACTTATTCCATGAGG + Intergenic
1096994735 12:55831421-55831443 AAGTCCCTGCTTATTCCATGAGG + Intergenic
1097324890 12:58265330-58265352 ATCCCTCTGCCTATTCCATGAGG - Intergenic
1097350144 12:58539544-58539566 AATTTCTTGCCCATACCATGAGG - Intergenic
1097677379 12:62617340-62617362 AATTTTCTGCCTATTCCATGGGG - Intergenic
1098476277 12:70907884-70907906 ATTTTTCTGCCTTTTCCCAGAGG - Intronic
1099573298 12:84352990-84353012 AAGTTTATCTCTATTCCATGGGG + Intergenic
1103482556 12:121260366-121260388 CGTCTCCTGCCTATTCCATGTGG - Intronic
1104127617 12:125862546-125862568 CACTTTCTGACTCTTCCATGAGG - Intergenic
1107717289 13:43213386-43213408 TATTTTCTGCCTCTTCAATAAGG + Intergenic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1108730253 13:53227898-53227920 AATTGTGTCCCTATTCCCTGAGG + Intergenic
1109727476 13:66362376-66362398 AATTTTCAGGCTATTCCATCAGG + Intronic
1110895244 13:80742590-80742612 AATCTTCTGACTTTACCATGTGG + Intergenic
1111185043 13:84723197-84723219 AATTTTCTGCCTATTCAAAAAGG - Intergenic
1111583675 13:90256787-90256809 TATTTTATGCCTTTTCCCTGGGG - Intergenic
1111989391 13:95101986-95102008 AAAATTCTACCTATTCCATGAGG - Intronic
1115322215 14:32094510-32094532 AATTTTCTGAGTATTCTGTGGGG + Intronic
1115501853 14:34057091-34057113 AATTTTTTGCCTATTAAATTAGG - Intronic
1117332348 14:54725556-54725578 CATTTTCAGCCTATTACATGTGG - Intronic
1118096799 14:62546341-62546363 AATTCTCTCCCTGTGCCATGTGG - Intergenic
1118306706 14:64661137-64661159 ACTTTTCTGCCTATTGCAGGAGG + Intergenic
1118386516 14:65259943-65259965 AAATTTCTCCCTATTCCGAGAGG + Intergenic
1118691889 14:68347947-68347969 AATTTGCTGAATATTCCATGTGG + Intronic
1119087187 14:71749450-71749472 AATTGTCAGCCTTTGCCATGGGG - Intergenic
1124898905 15:33804237-33804259 AATTTTGACCCTATCCCATGTGG - Intronic
1126271068 15:46817467-46817489 AATCCTCTGCCTAATCCATTTGG - Intergenic
1126281444 15:46956002-46956024 TGTTTTCTTCCTTTTCCATGTGG - Intergenic
1127631284 15:60829506-60829528 AAGTTTCTTCCTAGTCAATGTGG - Intronic
1128017078 15:64356830-64356852 TCTTTTTTGCCTATTCCATTTGG - Intronic
1128525159 15:68407297-68407319 AATTTAATGCCTCTTCCTTGTGG - Intronic
1129903207 15:79167510-79167532 AATATTCAGCCTATAACATGGGG + Intergenic
1132220718 15:100103101-100103123 ATGTTCCTGCCTCTTCCATGCGG - Intronic
1137513880 16:49125660-49125682 AATTTGCTTCTTATTTCATGAGG - Intergenic
1137768906 16:50999274-50999296 AATTTTCTGCCAAATGCATTGGG - Intergenic
1139004169 16:62551004-62551026 ATTTTTCTTTCTATTTCATGGGG - Intergenic
1141785321 16:86196113-86196135 AATTTGCTGCCTAAACCCTGAGG - Intergenic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1144309571 17:14000146-14000168 AATTTTCTTCCTGTTTCTTGGGG - Intergenic
1147767088 17:42844495-42844517 AATTTCCTGCCCAACCCATGGGG + Intergenic
1154081915 18:11265509-11265531 CATTTTCTTCCTTTGCCATGTGG + Intergenic
1154335848 18:13463913-13463935 AAATTTCTGCCTCTTATATGTGG + Intronic
1155165760 18:23231098-23231120 TATTTTCTGCCTATTGCCTCTGG - Intronic
1155671566 18:28378024-28378046 AGGCTTCAGCCTATTCCATGGGG - Intergenic
1158497715 18:57971331-57971353 TTCTTTCTGCCTATTCCCTGAGG + Intergenic
1158802084 18:60923905-60923927 TATTTTCTCCCTACTCCATCTGG - Intergenic
1162222393 19:9189029-9189051 AAGTTTCTGCCAACTCTATGGGG + Intergenic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1163613300 19:18311906-18311928 AGTTTCCTCCCTATACCATGGGG + Intronic
1163946924 19:20546218-20546240 AATTTTCTTTTTATTCTATGTGG - Intronic
1167035127 19:46990696-46990718 AAATTTCTGCCTACACCATCAGG - Intronic
927074831 2:19567242-19567264 CATGTTCTGCCTATTCCCTGGGG - Intergenic
927234425 2:20857343-20857365 GATTTTCTACGTATTCCAAGAGG + Intergenic
927587919 2:24325601-24325623 ATTTTTCTGCCTCTTCGATAAGG - Intronic
927723326 2:25401622-25401644 AAATTCTTCCCTATTCCATGAGG - Intronic
929351842 2:40965746-40965768 TATTTTCTGCCTCTTCCACCAGG + Intergenic
931804153 2:65788481-65788503 AATTGTCTGCCTTTTGCAGGTGG - Intergenic
932349144 2:71018067-71018089 ATTATTCTTCCTATTCCAGGAGG - Intergenic
932506347 2:72235713-72235735 AATATGCTGCCTGTTTCATGTGG + Intronic
932976080 2:76601754-76601776 AATTTTCTGACTTATTCATGTGG - Intergenic
933087168 2:78068713-78068735 AATTTTCTTTGTATTGCATGTGG + Intergenic
935323879 2:101917200-101917222 AATCTATTTCCTATTCCATGAGG - Intergenic
936253214 2:110884844-110884866 AATTTTCTGCCAAATGCATTGGG - Intronic
937003657 2:118491273-118491295 AGTTTTCTGGCTGTTCCCTGAGG - Intergenic
938030087 2:127984850-127984872 CATTTTCTACCTATGCCATGTGG - Intronic
939655789 2:144822774-144822796 AATTTTCAGCTCATTCCATGAGG + Intergenic
941434534 2:165452914-165452936 AATTTTCTGCTCATTGCATCAGG + Intergenic
941979954 2:171444422-171444444 AATTTTGTGCCTGTCACATGAGG - Intronic
943424261 2:187709960-187709982 AATTTTCTCTCTTTTCCATTAGG + Intergenic
943435622 2:187862650-187862672 TATTTCCTGACTATTGCATGTGG + Intergenic
944042572 2:195372980-195373002 AACTTTCCACCTAATCCATGAGG - Intergenic
944363415 2:198886623-198886645 CATTTTCTTCCTATTCAAGGAGG + Intergenic
945109017 2:206344973-206344995 AATTTTCTGTTTAGTCCATTTGG - Intergenic
945321729 2:208432282-208432304 AAGTTTCTGCCTTTTCCCTGTGG + Intronic
945771154 2:214044692-214044714 AATTTTCTCTCCATCCCATGTGG - Intronic
946172415 2:217903361-217903383 AATCTTCTGCCTACTCCGCGTGG + Intronic
947683134 2:232054292-232054314 AACTTTCTGTATGTTCCATGAGG - Intronic
948511481 2:238468435-238468457 AATTTTCTGCCGTTTCCTTCTGG + Intergenic
1168843230 20:923164-923186 TATTTTCTGGCTTTTCTATGAGG - Intergenic
1169525304 20:6417930-6417952 AATTTTCTGCATTTGCAATGTGG + Intergenic
1169724118 20:8710886-8710908 ATTTTTCTGGCTATGCCAAGGGG - Intronic
1171133885 20:22679109-22679131 ATTTTTCTGCCAATGACATGAGG - Intergenic
1175440623 20:58988519-58988541 GTTTTTCTGGCTACTCCATGTGG + Intronic
1176253272 20:64137298-64137320 AATTTTCTTTTTATTACATGAGG + Intergenic
1177227280 21:18273612-18273634 TATTTTCTGCCTAGTGCGTGAGG + Intronic
1177609838 21:23432318-23432340 AAGTTTCTGCCTATGCCACCAGG - Intergenic
1177690612 21:24501748-24501770 ATTTTTATGTCTATTACATGAGG + Intergenic
1178285817 21:31324481-31324503 AATTTTCTGACAATTCTATCAGG + Intronic
1179221864 21:39415214-39415236 CATTTTCTGTCATTTCCATGGGG + Intronic
1181835425 22:25603340-25603362 AATTTTCTACTTTTTCCATTTGG + Intronic
950166301 3:10802698-10802720 AATTTTCTGCCAAATGCATTGGG + Intergenic
954440368 3:50518438-50518460 AAATCTCTGCCCCTTCCATGAGG - Intergenic
954629244 3:52039342-52039364 CATTTTCTCCCTTCTCCATGTGG - Intergenic
956672309 3:71702780-71702802 AATATTCTACCTATTGGATGAGG - Intronic
956913917 3:73850869-73850891 AATTTTCTGCATAATCAAAGTGG + Intergenic
957025398 3:75176100-75176122 AAATTTCTGATTTTTCCATGGGG - Intergenic
962218173 3:133540878-133540900 CATTACCAGCCTATTCCATGTGG + Intergenic
962632415 3:137292240-137292262 AATTTTCTGCCTACTTAATTGGG + Intergenic
962654838 3:137532646-137532668 AGTTTTCTGCCTATTCATTTAGG - Intergenic
963435548 3:145260713-145260735 AATTTTCTTCCTTTCCCATCTGG - Intergenic
964137152 3:153357022-153357044 AGTTTTCTGGCCTTTCCATGTGG + Intergenic
965813817 3:172616883-172616905 AATTTTCTGCCAAATGCATTGGG + Intergenic
966293922 3:178395543-178395565 AATTTTCAGCTGATTCCATTTGG + Intergenic
966772613 3:183517513-183517535 CCTTTTCTGCCCACTCCATGAGG - Intronic
968380008 4:85472-85494 ACTTTCCTTCCTGTTCCATGTGG + Intronic
968740229 4:2324831-2324853 AATTTTCTGAGTAAGCCATGGGG - Intronic
971031230 4:22639448-22639470 AATTTTCTTCCTTTTTCAGGTGG + Intergenic
971230465 4:24796979-24797001 ACTTTCCTGCCTACTCCCTGGGG + Intronic
971568119 4:28171420-28171442 AATTTTCTTCCTATAAAATGGGG - Intergenic
971867198 4:32189024-32189046 AAGTTTCTGTTTATTCCAAGTGG - Intergenic
972125406 4:35758968-35758990 GATTTTCTTTCTACTCCATGTGG + Intergenic
972228969 4:37048384-37048406 AATATGGTGCCTATTCCATTTGG - Intergenic
973182695 4:47289107-47289129 AATTTTTTGACTCTTCCCTGAGG + Intronic
975233875 4:71968646-71968668 AATTTTCTGTTTTTTCCAAGAGG + Intergenic
976287151 4:83381707-83381729 GATATTCTGCCTATTCCAGAAGG + Intergenic
977424992 4:96857174-96857196 AATTTTTTTCCTATCCCATATGG + Intergenic
978035016 4:103982031-103982053 AGTTTACTTCTTATTCCATGGGG + Intergenic
979029438 4:115622098-115622120 AGTTTTCTACATGTTCCATGAGG - Intergenic
979351540 4:119649560-119649582 CATTTTCTCCCTCTGCCATGTGG + Intergenic
980034599 4:127869279-127869301 AATTTTGTGCCTATTCCCTGAGG + Intergenic
981427547 4:144621135-144621157 AATTTTCTCCTAACTCCATGAGG + Intergenic
984011876 4:174381299-174381321 AATTATGTGCATATTCCAAGAGG + Intergenic
985262281 4:188126219-188126241 ACTTTTCTGACTCTTCCATGAGG + Intergenic
988890662 5:35613493-35613515 AATTTTCTACTTATTTGATGTGG - Intergenic
991059513 5:62358324-62358346 AATTTTGTTCTTATGCCATGTGG + Intronic
991922479 5:71670525-71670547 AATTTTCTAGCTTTTCCTTGGGG - Intergenic
993078660 5:83268702-83268724 GATTTTCTCCGTATTCCATAAGG - Intronic
993626568 5:90232113-90232135 AATTACCTGCCTCTCCCATGAGG - Intergenic
998017194 5:138741817-138741839 TATTTTCTGCCTCCTCCATTAGG - Intronic
1000043626 5:157503599-157503621 CAATTTCTGCCCATTGCATGAGG + Intronic
1000354643 5:160382361-160382383 AATTCTCTGCCTATTCTAAGAGG - Intergenic
1000730112 5:164824408-164824430 AATTTTCTTCCTATTTCCTAAGG + Intergenic
1000798579 5:165695479-165695501 AACTTTCTACCTTTTCGATGTGG + Intergenic
1001184996 5:169562040-169562062 CTTTTTCTGCAAATTCCATGGGG - Intergenic
1001745708 5:174090747-174090769 AATTTGCTACCTTGTCCATGAGG - Intronic
1005089542 6:22042319-22042341 ATTGTTCTGGGTATTCCATGAGG - Intergenic
1009757573 6:67959167-67959189 AATTGTCTAGCTATCCCATGAGG + Intergenic
1010332951 6:74646159-74646181 ACTGTACTGCCTGTTCCATGGGG - Intergenic
1011995702 6:93584883-93584905 AATTTTGTGCCTATTTACTGTGG - Intergenic
1012663464 6:101934889-101934911 AATTTTCTGCATATGCAAAGTGG - Intronic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015152672 6:130056323-130056345 ACTTTTCTGCTTATTCTGTGTGG + Intronic
1015154050 6:130071262-130071284 AATTTTTTACCTGTTCCATATGG + Intronic
1015689340 6:135904110-135904132 AATTTCTTGCCCATTCCCTGTGG - Intronic
1016272492 6:142304248-142304270 TATTTTCTGCCTCCTCCTTGTGG + Intronic
1018493705 6:164325583-164325605 TATTTTCTGCATATTTCATCAGG - Intergenic
1020595954 7:10207837-10207859 TATTTTCTGCCTGTTCCTTGTGG - Intergenic
1022204078 7:28146646-28146668 AATTGTCTCCCTATTCCAAATGG + Intronic
1022343978 7:29495983-29496005 AATATTGTGCCAATTTCATGTGG + Exonic
1022767830 7:33434884-33434906 CACTTTCTGCATATTTCATGAGG - Intronic
1028289501 7:89047000-89047022 TATTTTCTGGCTATTCCTTAGGG + Intronic
1028939096 7:96500569-96500591 TATTTTGTGCATATTCCAGGGGG + Intronic
1029041200 7:97576908-97576930 AACTATTTACCTATTCCATGTGG + Intergenic
1032800500 7:135313877-135313899 AATTTTCTCACTGTTCCTTGTGG - Intergenic
1032853536 7:135815470-135815492 AATTATCTCCATTTTCCATGGGG - Intergenic
1033051423 7:138007745-138007767 TATTTTCTGCCTTTTACATTAGG - Intronic
1035891110 8:3344268-3344290 CACTTTCTGCCAATGCCATGAGG + Intronic
1036627863 8:10486648-10486670 AAATTGCTGACTACTCCATGAGG - Intergenic
1037449688 8:19004158-19004180 AATTCTCTGTCTAATCCAGGAGG + Intronic
1038182899 8:25245475-25245497 ATTTTTCTAACTCTTCCATGTGG + Intronic
1039590191 8:38739865-38739887 AAGTTTCTGCCTGCCCCATGGGG + Intronic
1043393620 8:79815155-79815177 AATCTTCTTTCTACTCCATGGGG - Intergenic
1043412528 8:80013216-80013238 AATTTTCTTCCAATTCTATAAGG + Intronic
1045939256 8:107718771-107718793 ATTATTCTGCCTCTTCCATTTGG - Intergenic
1046395680 8:113635180-113635202 CATTTTCTGGCTCTTCCATATGG - Intergenic
1046964000 8:120142571-120142593 AATGTATTGCCTATTCCATTAGG + Intronic
1047434968 8:124828766-124828788 AACTTTCTGGAGATTCCATGAGG - Intergenic
1050332806 9:4562519-4562541 AATTTTCTCCCTCTTACAAGTGG - Intronic
1050933605 9:11363975-11363997 AATTTTCAGCTTATTCTTTGAGG + Intergenic
1051234339 9:14982690-14982712 AGTTTTCTACCTGTTACATGAGG - Intergenic
1051500735 9:17774797-17774819 AATTTCCTGCTCATTCTATGAGG - Intronic
1052242667 9:26293180-26293202 AATTTTTTGCCTATCCCCTGTGG - Intergenic
1052253047 9:26422691-26422713 AAGTTTATTCCTATTACATGGGG - Intergenic
1052265800 9:26571773-26571795 AATTTTCTGCCAAATGCATTGGG + Intergenic
1052348394 9:27433545-27433567 AATTCTCTGCCTTCTTCATGGGG + Intronic
1054713656 9:68536515-68536537 AGTATTCTGTCTATTCCATTTGG + Intergenic
1056678177 9:88694663-88694685 AAGATTCAGCCTATTCCCTGGGG + Intergenic
1058169945 9:101668672-101668694 AATTTCTTGCCTAGTCAATGAGG + Intronic
1058415301 9:104781816-104781838 AAATTTCTGTATATTCCCTGTGG - Exonic
1058772767 9:108253511-108253533 AAATTTTGCCCTATTCCATGTGG + Intergenic
1060336339 9:122726708-122726730 AATTTCCTACCAAATCCATGTGG - Intergenic
1187479739 X:19644179-19644201 AACTGTCTGCCTACTCCCTGTGG - Intronic
1188042454 X:25385181-25385203 AATTCTCTGTCACTTCCATGAGG + Intergenic
1188894635 X:35651983-35652005 AATTTTCTTACTATTGCATTAGG + Intergenic
1189181920 X:39012547-39012569 AATATTCTCCCTATTCCAACTGG + Intergenic
1189768157 X:44393244-44393266 ACTTTTGAGCCTCTTCCATGGGG - Intergenic
1190829245 X:54045197-54045219 AATTTTCTGACTATAGCCTGAGG + Exonic
1190960747 X:55244481-55244503 ATTTTTCTGGCTTTTCAATGTGG - Intronic
1191894908 X:65982081-65982103 AATTTTCTCCCTATAAAATGGGG + Intergenic
1192145779 X:68681489-68681511 ACTTTTCTGCCAAGTGCATGTGG + Intronic
1194073663 X:89360926-89360948 AATATTCTGCCTTTTCTTTGGGG - Intergenic
1196665803 X:118314861-118314883 AATTTTCTGCCAAATGCATTGGG + Intergenic
1197028591 X:121785837-121785859 AATTTTCTGCTTAATGCATAAGG + Intergenic
1197077156 X:122365515-122365537 ATTTTTCTCTCTTTTCCATGTGG + Intergenic
1200729043 Y:6712493-6712515 AATATTCTGCCTTTTCTTTGGGG - Intergenic
1201254038 Y:12089482-12089504 ATTATTCTGTCTATTACATGGGG + Intergenic