ID: 1097678499

View in Genome Browser
Species Human (GRCh38)
Location 12:62627523-62627545
Sequence TGCCATGGTTAAGTTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097678496_1097678499 -10 Left 1097678496 12:62627510-62627532 CCCCTTTGCTTTCTGCCATGGTT No data
Right 1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG No data
1097678494_1097678499 14 Left 1097678494 12:62627486-62627508 CCTTGTGAAGAAGGTGCATTGCT No data
Right 1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG No data
1097678491_1097678499 25 Left 1097678491 12:62627475-62627497 CCTTCCTGCTGCCTTGTGAAGAA 0: 189
1: 434
2: 926
3: 1147
4: 1416
Right 1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG No data
1097678493_1097678499 21 Left 1097678493 12:62627479-62627501 CCTGCTGCCTTGTGAAGAAGGTG 0: 320
1: 678
2: 1113
3: 1567
4: 1833
Right 1097678499 12:62627523-62627545 TGCCATGGTTAAGTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097678499 Original CRISPR TGCCATGGTTAAGTTTCCTG AGG Intergenic
No off target data available for this crispr