ID: 1097682658

View in Genome Browser
Species Human (GRCh38)
Location 12:62663472-62663494
Sequence GCAAATTTTGGCTGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1416
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 1335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097682658_1097682662 -3 Left 1097682658 12:62663472-62663494 CCACCATGCCAGCCAAAATTTGC 0: 1
1: 0
2: 3
3: 77
4: 1335
Right 1097682662 12:62663492-62663514 TGCATTTCTAACAAGTTCCCAGG 0: 180
1: 761
2: 1549
3: 2220
4: 2482
1097682658_1097682665 24 Left 1097682658 12:62663472-62663494 CCACCATGCCAGCCAAAATTTGC 0: 1
1: 0
2: 3
3: 77
4: 1335
Right 1097682665 12:62663519-62663541 GCTGATGCCATGTAGCTCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097682658 Original CRISPR GCAAATTTTGGCTGGCATGG TGG (reversed) Intronic