ID: 1097687744

View in Genome Browser
Species Human (GRCh38)
Location 12:62707042-62707064
Sequence CTAGGTGCCCAGTTTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097687742_1097687744 -9 Left 1097687742 12:62707028-62707050 CCAAATTTTCATACCTAGGTGCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1097687744 12:62707042-62707064 CTAGGTGCCCAGTTTTCTATAGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097687744 Original CRISPR CTAGGTGCCCAGTTTTCTAT AGG Intronic
901687183 1:10949431-10949453 TTGGGGGCCCAGCTTTCTATGGG + Intronic
903920261 1:26795003-26795025 GCAGGTGCCCAATTTTCTACTGG + Exonic
904013350 1:27402842-27402864 CCTGGTGCCCAGTTTTATAAGGG - Intergenic
905557600 1:38899560-38899582 CTAGGTGCCCAGTGTTCCCAAGG - Intronic
907061353 1:51429168-51429190 CCAGGAGCACAGTTTTGTATGGG + Intronic
907157714 1:52349808-52349830 CCAGGTGACCAGTTATCTAGAGG - Intronic
909587134 1:77302581-77302603 CTAGGTGCCCTGTTTTTTGGTGG + Intronic
911161874 1:94689386-94689408 GTAGGAGCCCATTTTTCTAAAGG - Intergenic
911989284 1:104671829-104671851 CTAGGTGCCCAAGTTACTAAAGG - Intergenic
912194621 1:107382885-107382907 CTAGGTGCACTCTTCTCTATTGG + Intronic
912611369 1:111048477-111048499 CTATTTGCCCACTTTTTTATAGG + Intergenic
912660252 1:111521593-111521615 TTTTGTGCCCATTTTTCTATTGG + Intronic
913415440 1:118601022-118601044 CTAGTTGCTCTGTTTTCTCTGGG + Intergenic
914327451 1:146634250-146634272 CTATTTGCCAATTTTTCTATTGG - Intergenic
917544395 1:175948261-175948283 TTAGATGCCCAGTTTCCTACAGG - Intronic
917897080 1:179502121-179502143 CTTTTTGCCCATTTTTCTATTGG - Intronic
1063238392 10:4142919-4142941 CTGTTTGCCCATTTTTCTATTGG + Intergenic
1065640472 10:27777339-27777361 CTAGGCTCCCAGCTTTCTATAGG + Intergenic
1068707222 10:60090387-60090409 CTGGGTTTCCAGTTTTGTATAGG - Intronic
1069263284 10:66427550-66427572 AAATGTACCCAGTTTTCTATTGG + Intronic
1077462747 11:2718799-2718821 CCAGGTGCCCATTTTACTACAGG + Intronic
1077645744 11:3922394-3922416 CTTTTTGCCCAGTTTTCCATTGG + Intronic
1077791597 11:5446940-5446962 CCAGATGCCCAGATTTCTCTGGG - Intronic
1080251487 11:30238772-30238794 TTAGCTTCCAAGTTTTCTATGGG + Intergenic
1081488865 11:43551719-43551741 CTAGGTACTCAGTTTTATAAAGG + Intergenic
1085816782 11:79745827-79745849 TGAGGTGCCCAGTTTTCTCCTGG + Intergenic
1090757934 11:129811003-129811025 CTATGTGCCTATTTTTATATTGG - Intergenic
1094223137 12:28016145-28016167 CTGAATGCCCAGTTTTCTCTGGG - Intergenic
1097687744 12:62707042-62707064 CTAGGTGCCCAGTTTTCTATAGG + Intronic
1098324206 12:69284194-69284216 CGAGTTGACCATTTTTCTATTGG - Intergenic
1104129700 12:125881488-125881510 CAAGGAGCCCAGTTTTCTCTTGG - Intergenic
1120004019 14:79336366-79336388 CTCAGTGCCCGGTTTTCTTTTGG - Intronic
1124819163 15:33026829-33026851 CTACCTGCCCAGGTTTCTAAGGG + Intronic
1125892718 15:43278142-43278164 GGAGCTGCCCAGTTCTCTATTGG + Intronic
1127052387 15:55098207-55098229 CAAGGTGCAAAGTTTTCTGTAGG - Intergenic
1127231673 15:57003115-57003137 GCAGATGCCCACTTTTCTATGGG + Intronic
1128868148 15:71131506-71131528 TTATTTGCCCATTTTTCTATAGG - Intronic
1130057055 15:80535560-80535582 CTGTGTGCCCATTTTTCTACTGG + Intronic
1134785002 16:16934238-16934260 GTTGGTGCCCATTTTTCCATGGG + Intergenic
1136685562 16:31992695-31992717 CCATGTGCCCATTTTTCTGTTGG + Intergenic
1136883597 16:33917569-33917591 CCATGTGCCCATTTTTCTGTTGG - Intergenic
1137420947 16:48333499-48333521 CCAGGTGTCCTGTTTTCTAACGG - Intronic
1137678748 16:50319864-50319886 GTACGTGCCCTGTTTTCTCTGGG - Intronic
1138363607 16:56453726-56453748 CTAGGTACACAGGTTTCTATGGG + Intronic
1138363878 16:56456341-56456363 CTAGGTACACAGGCTTCTATTGG + Intronic
1140006109 16:71076690-71076712 CTATTTGCCAATTTTTCTATTGG + Intronic
1140664419 16:77214526-77214548 CTAGGTGCCCAGTGGTAAATCGG - Intergenic
1141418720 16:83898094-83898116 CTAGGTGCTAGGATTTCTATAGG - Intergenic
1203088412 16_KI270728v1_random:1197892-1197914 CCATGTGCCCATTTTTCTGTTGG + Intergenic
1144640261 17:16932922-16932944 GAAGATGCCCAGTTTTCTGTAGG + Intronic
1152350834 17:79783326-79783348 CAAGGTGCCCAGTGTTCCTTGGG + Intronic
1153444905 18:5160408-5160430 TTATGTGCCCATTTTTCTACTGG + Intronic
1155039677 18:22054348-22054370 CTGGGTCCCCAATTTTCCATGGG - Intergenic
1157008407 18:43616018-43616040 CAATGTGTACAGTTTTCTATAGG + Intergenic
1157969257 18:52247521-52247543 CTAGCTGTCAACTTTTCTATAGG - Intergenic
1161729177 19:5948478-5948500 CTTGGTTGCCAGTTTTCTAGGGG - Intronic
1165180945 19:33968195-33968217 CTAGGTGCAAGGTTTTATATAGG + Intergenic
1166828732 19:45625674-45625696 CTCCGTGCCCAGTGTTCTCTGGG + Intronic
925499278 2:4486012-4486034 CTGAGTGCCCAGTTTTCCAGCGG - Intergenic
925674360 2:6344595-6344617 CTAGGTGCATTGTTTTCTAAAGG + Intergenic
926291130 2:11531185-11531207 GTAGGTTCCCAGTTTACTGTGGG + Intergenic
929585979 2:43114743-43114765 TTTGGTGCCCAATTGTCTATAGG - Intergenic
931378035 2:61725380-61725402 ATATGTGCCTAGTTTTCTTTGGG + Intergenic
932730527 2:74218490-74218512 ATAGATCTCCAGTTTTCTATAGG + Exonic
933805928 2:85998091-85998113 CTTGGTGCCCAGAGTTCTAAGGG - Intergenic
934938512 2:98482481-98482503 CTAGGTGCCCACCTTTCTGTTGG - Intronic
936574305 2:113640919-113640941 CCAGGTGCTCAGGTTCCTATAGG - Exonic
937171192 2:119871045-119871067 CTATCTTCCCATTTTTCTATTGG - Intronic
937639451 2:124194999-124195021 CTATTTGGCCAGTTTTCTATTGG - Intronic
938384643 2:130855574-130855596 CTTGGTGCCCAGGTTTTTATTGG + Intronic
939043190 2:137216882-137216904 TTAGCTGCCTAGTTGTCTATGGG + Intronic
941304294 2:163842442-163842464 ATATGTGACCAGTTTTCTAAAGG + Intergenic
944728188 2:202493208-202493230 CTAGGTTTCCATTTTTCTAGTGG + Intronic
945694281 2:213083249-213083271 CTATGTGACCAGTTTCCTACTGG - Intronic
947683593 2:232059878-232059900 CTAGGTGCCCAGTCCAATATTGG - Intronic
948558095 2:238831283-238831305 GTAGGTGCACAGTTATCTCTTGG - Intergenic
948611747 2:239173565-239173587 TTAGGTGCCATGTTTTCTGTAGG - Intronic
948989877 2:241548354-241548376 CTGGGAGCCCAGGTTGCTATGGG + Intergenic
1170574313 20:17650970-17650992 ATAGGTGCTCAGTTAACTATCGG + Intronic
1170868264 20:20180185-20180207 ACAGGTGCCCAGTTTTTAATGGG - Intronic
1170921296 20:20682206-20682228 CTGTGTGCCCAGTTTTATTTTGG - Intronic
1174086562 20:48012812-48012834 CTGTGTACCCAGTTGTCTATTGG - Intergenic
1178480306 21:32974497-32974519 CGAGGTGCCCTGTTCTCAATCGG - Intergenic
1179717441 21:43297183-43297205 TTTGGTGTCCAGTTTTTTATCGG + Intergenic
1180579546 22:16818770-16818792 CTGGGTGCTCAGCTTGCTATTGG - Intronic
1182028647 22:27139895-27139917 CCAGGTGCCCAGCTTTCTCTGGG - Intergenic
1184942480 22:47779386-47779408 CCAGGAGCACAGTTTTCTCTGGG - Intergenic
1185425867 22:50769969-50769991 CCAGGTGCTCAGGTTCCTATAGG + Exonic
958881381 3:99674948-99674970 TTGGGTGCTCAGTTTTCTTTCGG + Intronic
960396712 3:117146534-117146556 ATATGTACCCAGTTTTCTAATGG - Intergenic
960843580 3:121986102-121986124 CTAGCTGCCCAGATTTCTCTGGG + Intergenic
961118303 3:124350581-124350603 CTAGGTGCCCATTTGCTTATGGG + Intronic
962895730 3:139713018-139713040 GTAGGTGCCCATTTTTCTTATGG - Intergenic
962992137 3:140587692-140587714 TTATTTGCCCATTTTTCTATTGG - Intergenic
965185308 3:165455093-165455115 CTAGGGTCTCAGGTTTCTATGGG + Intergenic
965552545 3:169983272-169983294 CTAGAAGTTCAGTTTTCTATAGG + Intronic
968527749 4:1072354-1072376 CTAGGTGTCGAATGTTCTATGGG - Intronic
971780596 4:31029372-31029394 CTAGGTGCCCAGACATCTAGAGG + Intronic
972939461 4:44179904-44179926 CTAGTTGCCCAGTTTTCTTGTGG + Intronic
976685940 4:87815029-87815051 CTATGTGCCTATTTTTATATTGG + Intergenic
977621600 4:99144211-99144233 CTTGGTGCCCATTTTTCTTTGGG + Exonic
985201042 4:187485827-187485849 ATAGCTACCCAGTTTTCTCTAGG - Intergenic
985797888 5:1977176-1977198 CAAGGTGCCCAGTGTTCTTGGGG - Intergenic
986007692 5:3681867-3681889 CTAGGTCCCCAGTTCTCTCCTGG + Intergenic
987684696 5:21182176-21182198 CCAGGTGACCACTTTTCTATGGG - Intergenic
992871081 5:81006270-81006292 CTCAATGCACAGTTTTCTATGGG + Intronic
993353370 5:86877032-86877054 CCAGGTAGCCAATTTTCTATTGG - Intergenic
994612031 5:102055348-102055370 CTGTGTGCAGAGTTTTCTATGGG - Intergenic
995892047 5:116965324-116965346 CTCAGTGCCCTGTTTTCTCTGGG - Intergenic
996409552 5:123143445-123143467 CTAGGTGCCTTCTTTTCTTTGGG + Intronic
999007053 5:147993629-147993651 TTAGGAGCACAATTTTCTATTGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000716763 5:164653637-164653659 CTAGGTGCCCAGATTAATAATGG + Intergenic
1001359281 5:171064820-171064842 CTCCCTGCCCATTTTTCTATAGG + Intronic
1002937974 6:1690131-1690153 ATGGGTGCCCAGTTTTTTGTGGG - Intronic
1005811445 6:29519234-29519256 GAAGATGCCCAGTTTTCTATAGG - Intergenic
1007031574 6:38632613-38632635 ATAGGTGCCAAGTTTTCTAGAGG - Intronic
1008846388 6:55969246-55969268 CTTGGTTTCCAGTTTACTATGGG + Intergenic
1011326352 6:86152787-86152809 CTAGGTTCTCAGGTTTCTATAGG + Intergenic
1013290171 6:108712834-108712856 CCAGATGCCCAGTTTTTTTTGGG - Intergenic
1018878862 6:167854261-167854283 TTGGGTGCCCATTTTTCTATTGG + Intronic
1023319194 7:38975393-38975415 CTAGGTGCCAAGTACTGTATTGG - Intergenic
1024233919 7:47383852-47383874 CTAGGTGGACAGCTTTCTTTTGG - Intronic
1026048689 7:66926321-66926343 CTGGCTGCCCATTTTTCAATTGG - Intronic
1027395727 7:77751835-77751857 CTAAATGTCCGGTTTTCTATTGG + Intronic
1037135924 8:15460360-15460382 TTATTAGCCCAGTTTTCTATGGG + Intronic
1037251524 8:16900990-16901012 CTATGTGCCCCGCTTTGTATGGG - Intergenic
1037843952 8:22265842-22265864 CTAGGTGCCCAGTCTGTTGTGGG - Intergenic
1038196372 8:25372058-25372080 CTAGGTTCCCAGGTTCCTCTAGG + Intronic
1039190167 8:34964607-34964629 TTTGGTGGCCAGTTTTCTAATGG + Intergenic
1041425810 8:57719084-57719106 CTAGGTTACCAGTTTTCTAAGGG - Intergenic
1043177246 8:77037326-77037348 CTATGTGCCTATTTTTATATTGG - Intergenic
1046907281 8:119587277-119587299 CTAGGAGGGCAGTTTACTATAGG - Intronic
1050328433 9:4520658-4520680 CTAAGTGCCCAATTTATTATTGG - Intronic
1050741460 9:8825233-8825255 GTATGTGGCCAGTTTTCTAAAGG + Intronic
1051009309 9:12391313-12391335 CAAGGTGCTCACTATTCTATTGG + Intergenic
1052895657 9:33745834-33745856 CTATGTGCCTACTTTTATATTGG - Intergenic
1055143277 9:72901046-72901068 CTACATGTCAAGTTTTCTATGGG + Exonic
1059241217 9:112807445-112807467 CTAGGTGCCCAGTGGTGTAGTGG - Intronic
1059926313 9:119212788-119212810 CCATGTGCTCACTTTTCTATAGG - Intronic
1060307387 9:122427140-122427162 CTAGGTGCTCAGATTTCCAGTGG + Intergenic
1061530032 9:131203778-131203800 CTAGGTCCCCATTTTCCTTTTGG - Intronic
1062583204 9:137237266-137237288 CTAGGTGTCCAGTTACCCATTGG - Intergenic
1186188474 X:7044868-7044890 CTAGGTAAGCACTTTTCTATTGG + Intergenic
1186744145 X:12548688-12548710 TGAGCTGCCCAGTTCTCTATCGG - Intronic
1188399063 X:29722030-29722052 CTTTTTGCCCACTTTTCTATTGG + Intronic
1188489475 X:30722562-30722584 CTAGGTGCCCATTCGTTTATGGG - Intronic
1190322966 X:49189067-49189089 CTAGGTGCCCAGTCTTGAGTGGG - Exonic
1191844863 X:65539566-65539588 CTGGTTGCCCATTTTTTTATGGG - Intergenic
1194175180 X:90637511-90637533 CTATGTGTCCATTTTTGTATCGG - Intergenic
1195886212 X:109640397-109640419 CTAGGTTCTGAGTTTCCTATAGG - Intronic
1196281611 X:113829263-113829285 CTTGGTGCCCAGATTTTTACTGG - Intergenic
1197267854 X:124395305-124395327 ATATTTGCCCATTTTTCTATTGG + Intronic
1197836281 X:130697211-130697233 CTAGGTGTCCAGGTATATATAGG - Intronic
1200521824 Y:4218484-4218506 CTATGTGTCCATTTTTGTATCGG - Intergenic
1201057342 Y:10008527-10008549 ATGGGTGCCCTTTTTTCTATTGG - Intergenic