ID: 1097688050

View in Genome Browser
Species Human (GRCh38)
Location 12:62709467-62709489
Sequence CTGTGCCAGCAGAAGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097688050 Original CRISPR CTGTGCCAGCAGAAGCCCAG AGG (reversed) Intronic
900526962 1:3134135-3134157 AGGTCCCAGCAGGAGCCCAGAGG - Intronic
900618881 1:3577953-3577975 CTGTGCCTGCCGATGCCCCGGGG + Intronic
901470388 1:9452000-9452022 CTGTGCAGGCTGAAGCCTAGGGG + Intergenic
901524196 1:9809144-9809166 CAGTGACAGCATAAGGCCAGAGG - Intronic
902519831 1:17009973-17009995 CTGAGCCCACAGAAGCCCTGGGG - Intronic
903233586 1:21936241-21936263 CTTGGCCAGCAGAGGCCCTGAGG - Intronic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
904708668 1:32411855-32411877 CTCTGACTGCTGAAGCCCAGAGG + Intergenic
904777375 1:32918978-32919000 CTGTGGGAGCACAAGCTCAGGGG + Intergenic
904813109 1:33176609-33176631 CTGTGCCAGCTGACGCCCCGAGG - Intronic
906264296 1:44417121-44417143 CTGTCCCAGCTGCAACCCAGAGG - Intronic
907248313 1:53121863-53121885 CTGTGGCTTCAGAAGCCCGGGGG + Intronic
907632314 1:56095187-56095209 CCCTGCCTGCAGTAGCCCAGGGG + Intergenic
908844271 1:68308893-68308915 CAGTGCCAGCAGATACACAGTGG - Intergenic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
915085351 1:153384411-153384433 CTCTGCCAGCAGATGATCAGAGG + Intergenic
915739106 1:158104602-158104624 TGGTGCCTGCAGAAGCTCAGGGG - Intergenic
915977405 1:160400375-160400397 CTGCGCCTTCAGATGCCCAGCGG - Intergenic
916253735 1:162765126-162765148 CTATGCCAGGAGAATCCCTGAGG - Intronic
917739145 1:177946248-177946270 CTGTGCAAGGAGATGCCCCGTGG - Intronic
917833291 1:178916443-178916465 CTGTGCCAGGAAGAGCCCAGAGG + Exonic
918317054 1:183331139-183331161 CTCTCCCAGCAAAAGCACAGAGG + Intronic
920493888 1:206440438-206440460 GTGTACAAGCAGCAGCCCAGAGG + Intronic
921823222 1:219641158-219641180 CTGACCCAGCACAATCCCAGTGG + Intergenic
922110013 1:222547502-222547524 CAGGGCCAGCAGAATCCCAGAGG + Intronic
922574310 1:226652046-226652068 CTCTGCCAGCAGCAGCACACAGG + Intronic
924705754 1:246500625-246500647 CTGTACCAGCAGAAGCCACATGG + Intronic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1067058199 10:43064546-43064568 CTGACCCAGCAGGAGCTCAGGGG + Intergenic
1067826814 10:49580563-49580585 CGGTGCAAGCAGAAACACAGTGG + Intergenic
1069594743 10:69663284-69663306 CTGTGTCAGCAGGAGCCCACAGG - Intergenic
1069827435 10:71262760-71262782 CTGTGCCAAGTGAGGCCCAGGGG - Intronic
1070508391 10:77137667-77137689 CTGTGGGAACAAAAGCCCAGGGG - Intronic
1070759481 10:79014827-79014849 CTGAGCCAGCAAAAGACCAGTGG + Intergenic
1071567113 10:86677041-86677063 ATGTGCCCAGAGAAGCCCAGAGG + Intronic
1073499797 10:103926155-103926177 CTGTGTCAGCAGAAGGCCCCAGG + Intergenic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075264428 10:120988685-120988707 GGGTGACAGCAGGAGCCCAGGGG - Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075746984 10:124734872-124734894 CTGCACCAACAGAAGCCAAGCGG + Intronic
1076235958 10:128864045-128864067 TGGTGCCAGCTGAGGCCCAGTGG - Intergenic
1076451430 10:130559715-130559737 CTCTGCCAGCAGATGCCCTTTGG + Intergenic
1076714733 10:132357998-132358020 CTGGGCCAGCGCAGGCCCAGAGG - Intronic
1077261992 11:1627244-1627266 CTGTGCCAATAGCAGCCCTGTGG - Intergenic
1077383271 11:2257342-2257364 CTGGGCCAGCAGAACCACAGCGG - Intergenic
1077437321 11:2549236-2549258 CAGTGCCACCAGGAGCCCACTGG + Intronic
1077439673 11:2562096-2562118 CTGTGCCACCCTCAGCCCAGTGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1079254262 11:18813108-18813130 CTGTGCCCACAGATGCCCACAGG + Intergenic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1079929762 11:26543272-26543294 ATGTGCCAGCAGGAGATCAGAGG - Intronic
1080416405 11:32073371-32073393 CTGCCCCAGCAGAGGCCCTGAGG - Intronic
1080937029 11:36875036-36875058 CACTGCCAAGAGAAGCCCAGAGG + Intergenic
1083623472 11:64060173-64060195 CGGTGCCAGCATCTGCCCAGCGG + Intronic
1083689170 11:64396364-64396386 CTGTGCCCCCAGAGGGCCAGGGG + Intergenic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1084935842 11:72586250-72586272 CTGTTCCATCAGAAGCCCACAGG + Intronic
1085016677 11:73178415-73178437 CTGTGACAGCAGAAAGCCCGGGG + Intergenic
1085296776 11:75435857-75435879 CTGTGGCTGCAGAGTCCCAGGGG - Intronic
1087023343 11:93624934-93624956 CTGTGGGAGCTGAGGCCCAGGGG - Intergenic
1087934192 11:104013153-104013175 CTGGGACAGCAGAACTCCAGGGG + Intronic
1090564393 11:127971436-127971458 CCATGCTAGCAGAAGCCAAGTGG + Intergenic
1090598327 11:128343108-128343130 CTTTGGCAGCAGGAGGCCAGGGG + Intergenic
1092233251 12:6789575-6789597 CTCTGCAACCAGGAGCCCAGTGG - Exonic
1092899431 12:13044600-13044622 CTGTGCCACCAGAGGGCGAGAGG + Intronic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1100060921 12:90575094-90575116 CTGATCCAGCACAATCCCAGTGG - Intergenic
1100660458 12:96692756-96692778 CTTCTCCAGAAGAAGCCCAGTGG + Intronic
1101552296 12:105774001-105774023 TTGTACCAGCAGCTGCCCAGTGG - Intergenic
1102035687 12:109769388-109769410 CTGTGCCTGCTGATGCCCACAGG + Exonic
1103212816 12:119179082-119179104 CAGATCCAGCAGAATCCCAGAGG - Exonic
1103939345 12:124493334-124493356 CTGTACCTGCAGCTGCCCAGAGG - Intronic
1104025801 12:125025272-125025294 CTTCGCCAGTAGAAGCCCATGGG - Exonic
1104216279 12:126736870-126736892 CGGTTCCAGCAGAAGTCCTGGGG + Intergenic
1105401412 13:20099471-20099493 GGCTGCCAGCAGAACCCCAGGGG + Intergenic
1105462733 13:20607242-20607264 CTGCGGCAGCAGCAGGCCAGGGG - Intronic
1105541240 13:21319321-21319343 CTGTGCGAGCGGCAGCCCATCGG + Intergenic
1106419279 13:29572230-29572252 CTGTGCCCAGAGAAGCCCAGTGG + Intronic
1107215363 13:37911629-37911651 CACTGCCAGCAAAAGCCGAGTGG + Intergenic
1107582242 13:41802900-41802922 CTGACCCAGCACAATCCCAGTGG + Intronic
1108017143 13:46087232-46087254 CGGAGCCAGCAGAAGCCAGGAGG - Intronic
1108317273 13:49248931-49248953 TCTTTCCAGCAGAAGCCCAGCGG + Exonic
1109100611 13:58180296-58180318 CTGACCCAGCACAATCCCAGTGG - Intergenic
1110885993 13:80636508-80636530 CTGTCCCAGCACAGTCCCAGTGG - Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1113646435 13:111999816-111999838 CTGTGCCACCTGCAGGCCAGGGG - Intergenic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1114450943 14:22824985-22825007 CTTTGCCAGTTGAAGTCCAGAGG + Intronic
1117784197 14:59265687-59265709 CTGTGATAGCAAAACCCCAGTGG + Intronic
1119577169 14:75735352-75735374 CTGTGGGAGCAGAAGCACTGTGG + Intronic
1121413570 14:93763755-93763777 CTGAGCCAGCAGAGGACCAGAGG - Intronic
1123025960 14:105424151-105424173 CTGAGGCAGGAGAAGCTCAGTGG - Intronic
1123039829 14:105485966-105485988 CAGGGCCAGCACAGGCCCAGTGG + Intergenic
1123472268 15:20564251-20564273 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123645735 15:22436102-22436124 GTGTTCCAGCAGGAGCCAAGAGG - Intergenic
1123732573 15:23159242-23159264 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123750706 15:23356622-23356644 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124065604 15:26340918-26340940 CCGTGGCAGGAGAAGCACAGTGG + Intergenic
1124066246 15:26346914-26346936 CTCTACCATCACAAGCCCAGAGG + Intergenic
1124150173 15:27170254-27170276 ATGTGACAGCAATAGCCCAGAGG + Intronic
1124283077 15:28380538-28380560 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124299622 15:28531075-28531097 GTGTTCCAGCAGGAGCCAAGAGG - Exonic
1125700229 15:41676220-41676242 TTGTGCCAGCTGGAGTCCAGTGG + Intronic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1127971403 15:63965381-63965403 CTGACCCAGCACAATCCCAGTGG - Intronic
1128113398 15:65090440-65090462 ATGTTCCCGCAGAGGCCCAGTGG - Intergenic
1128310630 15:66629960-66629982 CTGTGCAGGAAGAAGCCCTGAGG - Intronic
1128392947 15:67195396-67195418 CAGTGCCAGCAGAAGCCCCTGGG + Intergenic
1128455444 15:67829039-67829061 CTGTGCCCGCTCAAGTCCAGCGG + Intronic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1130857664 15:87855413-87855435 CTGTTCTGGGAGAAGCCCAGGGG + Intergenic
1130950306 15:88581355-88581377 TTGTGCCTGCAAAAGCTCAGGGG - Intergenic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1131963384 15:97811737-97811759 AGGTTCCAGCAGAAGACCAGAGG + Intergenic
1132609049 16:805990-806012 CTTTGCCAGCAGAAGCCTCCAGG + Intronic
1132767557 16:1542116-1542138 CTGTGGCACCAGAAGGCCACAGG - Intronic
1133805378 16:9122621-9122643 CGGTGCCAAAAGCAGCCCAGTGG - Intergenic
1133927710 16:10206541-10206563 CTGGGCAAGCTGAAGCCCTGGGG + Intergenic
1134156005 16:11843969-11843991 GAGTGCAGGCAGAAGCCCAGTGG + Intronic
1134243365 16:12522056-12522078 CTGTGCCAGCAGGGGCCCCTCGG - Intronic
1136485200 16:30567263-30567285 CTATGACAGAGGAAGCCCAGAGG - Intergenic
1136690262 16:32023764-32023786 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1136790851 16:32967328-32967350 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1136878964 16:33886604-33886626 CTCTGCCAGCTGAAGGCCAGTGG - Intergenic
1137453939 16:48603795-48603817 CTGTGCCCTCTGAAACCCAGGGG - Intronic
1137778734 16:51078332-51078354 CTCTCCCATCAGAATCCCAGAGG - Intergenic
1137814883 16:51389029-51389051 CTTTGCCAGCAGAATGCCATGGG + Intergenic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1139113453 16:63919961-63919983 CTCTGCCATCATAGGCCCAGAGG - Intergenic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1139961224 16:70718635-70718657 CTGAGCCAGGAGAACCACAGGGG - Intronic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141601365 16:85128540-85128562 CTCTGGCTGCAGAAGCCCACAGG + Intergenic
1142105494 16:88300215-88300237 CTGTGCCTCCAGCAACCCAGTGG - Intergenic
1142351649 16:89583462-89583484 CGGCGCCAGCAGTCGCCCAGGGG - Exonic
1203093054 16_KI270728v1_random:1228785-1228807 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1142720095 17:1770190-1770212 CTGTGTAAGCAGGAGCTCAGGGG + Intronic
1143782537 17:9236808-9236830 CAGTGCCTGGAGAAGCACAGGGG + Intronic
1144733330 17:17541067-17541089 CTGTGACCCCAGAATCCCAGTGG - Intronic
1144739565 17:17574027-17574049 CTGTGATGCCAGAAGCCCAGTGG - Intronic
1145035732 17:19539354-19539376 CTGTGACAGCACAGTCCCAGAGG + Intronic
1145042035 17:19584173-19584195 TTGTGACAGCAGAAGCCACGGGG + Intergenic
1146506968 17:33414072-33414094 TTGTTCCCGCAGCAGCCCAGTGG + Intronic
1146925979 17:36745781-36745803 CCGTTTAAGCAGAAGCCCAGAGG + Intergenic
1147153117 17:38529899-38529921 CTCTGCCAGCTGAAGGCCAGTGG + Intergenic
1147188377 17:38725113-38725135 ATGTGCAAGCAGAGGCCCTGGGG - Intronic
1147540060 17:41349942-41349964 GTGCACCAGGAGAAGCCCAGAGG + Intronic
1147595618 17:41715373-41715395 CTGTCCCCACAGAGGCCCAGAGG - Intronic
1147772472 17:42877560-42877582 AAGTGTCAGCAGCAGCCCAGGGG + Intergenic
1147923930 17:43935299-43935321 ATGTGCCAGGAGCTGCCCAGAGG + Intergenic
1148158197 17:45435370-45435392 AAGTTCCAGGAGAAGCCCAGGGG - Intergenic
1148461196 17:47840005-47840027 CTGGGCCAGGAGAGGCCCAAAGG + Intronic
1148734735 17:49858979-49859001 CAGTGCCAGCTGAAGGCCGGGGG + Intergenic
1149381958 17:56103489-56103511 CCTTGCCAGCAATAGCCCAGGGG + Intergenic
1151383196 17:73739683-73739705 CTGATCCAGCTGAAGCCCAGTGG + Intergenic
1151703301 17:75754398-75754420 CTGTCCCTGCAGGAGCCCAAGGG - Intronic
1151820691 17:76495177-76495199 GTGGTCCAGCACAAGCCCAGCGG + Intronic
1152246083 17:79185239-79185261 CTGTGCCAGCACCACCCCAGAGG - Intronic
1152749661 17:82056817-82056839 CTGTGCAGGCACAAGCTCAGCGG - Intronic
1154294444 18:13136851-13136873 CGGTGCCAGAAAATGCCCAGAGG + Intergenic
1155745815 18:29355638-29355660 CTGGGCCAGCAGATGCACAGAGG + Intergenic
1155849466 18:30752832-30752854 CTGTACCATCAGAGGCCCTGAGG + Intergenic
1158980654 18:62757694-62757716 CTGTGCCAGCTGAGGACCACAGG - Intronic
1160231925 18:77055232-77055254 CAGGGTCAGCAGAAACCCAGAGG + Intronic
1160782989 19:886059-886081 GTGTCCCTGCTGAAGCCCAGCGG - Exonic
1160834015 19:1116281-1116303 CTGTGACACCAGGAGGCCAGAGG - Intronic
1161321593 19:3644023-3644045 GGGTGCCAGCAGCAGCCCCGTGG - Intronic
1162337890 19:10072932-10072954 CCATCCCTGCAGAAGCCCAGTGG + Intergenic
1163113884 19:15177999-15178021 CCATGCCAGCAGACGCCCCGCGG - Exonic
1163265234 19:16216911-16216933 ATGTGCCAGCGGCAGCACAGCGG + Intronic
1163812468 19:19442255-19442277 CTGTGCCAGCAGGGCCCCTGTGG - Intronic
1164618660 19:29681157-29681179 CTGTGCCCCCAGAGGCCCGGTGG + Intergenic
1164828750 19:31303782-31303804 TGGTGCCAGCAGAAGCACATGGG + Intronic
1164860578 19:31559114-31559136 GTTGGCCAGCAGCAGCCCAGGGG + Intergenic
1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG + Intergenic
1166408220 19:42539039-42539061 CTGACCCAGCACAATCCCAGTGG - Intronic
1167278800 19:48554373-48554395 CGGGGCCAGGAGAAGCCCTGTGG - Intronic
1168549971 19:57284654-57284676 CAGTGCGACCAGAAGCCCACAGG - Exonic
925259457 2:2517204-2517226 CTGTGCCAGCTGGAGCCAGGAGG + Intergenic
925480302 2:4262945-4262967 ATGTGCCAACAGAAGCCCATAGG - Intergenic
926366706 2:12139994-12140016 ATGTGCCAAGTGAAGCCCAGTGG - Intergenic
926476447 2:13328468-13328490 CTCAGCCATCAGAAGCCCAGTGG - Intergenic
926646923 2:15300083-15300105 CTGAGCCAGCAGAGGCCCCCTGG - Intronic
927146557 2:20169972-20169994 CTGCCCCAGCTGAAGCCAAGTGG - Intergenic
927295644 2:21449975-21449997 CTGTGCTAGGAGGAGCTCAGAGG - Intergenic
927515900 2:23671605-23671627 CTTTGGAAGCAGAAGCCCTGAGG + Intronic
927717646 2:25362918-25362940 ATGTCACTGCAGAAGCCCAGAGG + Intergenic
927895443 2:26778634-26778656 CTGTGGCAGCAGCTGCCCTGGGG - Exonic
928293653 2:30061850-30061872 CTGACCCAGCAAAATCCCAGTGG + Intergenic
928667779 2:33567820-33567842 CTGTGACAGCAGAATGCCAGAGG + Intergenic
928854976 2:35792281-35792303 CTGTGCCAGCTGATGTCAAGTGG - Intergenic
929699175 2:44147182-44147204 CTGTGGTAGCAAATGCCCAGGGG - Intergenic
929861980 2:45686127-45686149 GTATGCAAGCAGAAACCCAGAGG + Intronic
931089038 2:58866021-58866043 CTGTGCTAGCAGAATCCAAAAGG - Intergenic
931096076 2:58942716-58942738 CCCTCCCATCAGAAGCCCAGAGG + Intergenic
931271656 2:60708938-60708960 CTGTGCGAGCAGTGGGCCAGTGG - Intergenic
932335142 2:70926600-70926622 CTGTGCCACCCTCAGCCCAGAGG + Intronic
932471512 2:71962475-71962497 CTGGGCCAGCTGAAGCCATGTGG - Intergenic
933325194 2:80826863-80826885 CTGTGCCAGTAGATGGCGAGTGG - Intergenic
933841568 2:86290866-86290888 GTGAGTAAGCAGAAGCCCAGGGG - Intronic
934774399 2:96927943-96927965 CTGTGCCAGGAGGAGGCAAGTGG + Intronic
935435689 2:103029586-103029608 CTATGTAAGCTGAAGCCCAGAGG - Intergenic
936324566 2:111493768-111493790 GTCTCTCAGCAGAAGCCCAGAGG + Intergenic
938201503 2:129376544-129376566 CTGTGCCAGCAGGATTCCAGTGG + Intergenic
938866956 2:135432686-135432708 TTGGGCCAGCTGAAGCCTAGAGG - Intronic
939340979 2:140895773-140895795 CTGGGACAGCAGAACTCCAGGGG - Intronic
939677292 2:145088302-145088324 CTGCACGTGCAGAAGCCCAGGGG + Intergenic
940419615 2:153464292-153464314 CTGTGCCTCCAGGTGCCCAGGGG + Intergenic
944664125 2:201945575-201945597 CTGTGGAAGCTGAAGTCCAGAGG + Intergenic
945713429 2:213329784-213329806 CCCTGCCATCACAAGCCCAGAGG + Intronic
946737979 2:222773570-222773592 CTGTGCCAGAAAAAGCCAAAAGG - Intergenic
947795881 2:232893794-232893816 GTGCCGCAGCAGAAGCCCAGGGG + Intronic
947831898 2:233147329-233147351 CTGGGGCAAGAGAAGCCCAGTGG + Intronic
948982098 2:241499590-241499612 CACTGCCAGCAGGAGCCCAACGG + Intronic
1168886540 20:1263351-1263373 CTGTGACAGCAGGAACCCACAGG - Intronic
1170062437 20:12273154-12273176 CTCTCCCATCACAAGCCCAGAGG - Intergenic
1172795898 20:37537277-37537299 CCAGGGCAGCAGAAGCCCAGGGG - Intergenic
1172938202 20:38636003-38636025 TGGTGACAGCAGAAGCTCAGAGG + Intronic
1173666743 20:44768425-44768447 CTGGGCTGGCAGAAGCCCAAGGG + Intronic
1173954206 20:47018186-47018208 CTGTGGCCTCAGAAGCCCTGAGG - Intronic
1175159901 20:57000485-57000507 CTGTGCGACCTGAAGCCCAGAGG + Intergenic
1175281515 20:57807031-57807053 CTGTGCCAGGAGAAACCCTGAGG - Intergenic
1175618689 20:60424801-60424823 CTGTCCCGGCAGGAGCCAAGAGG - Intergenic
1175798629 20:61788114-61788136 CTGAGCTACCAGAAGGCCAGGGG + Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1176382361 21:6119790-6119812 CTCTGCGAGCAAAAGCCCCGCGG + Exonic
1176388928 21:6153738-6153760 GTGTCCCAGCCGAGGCCCAGAGG + Intergenic
1177732307 21:25043435-25043457 CACTAACAGCAGAAGCCCAGGGG + Intergenic
1178995285 21:37393764-37393786 CAGTGCCAGCAGATGCCACGTGG - Intronic
1179711689 21:43267271-43267293 CAGGGCCAGCAGGAGGCCAGGGG - Intergenic
1179734544 21:43384510-43384532 GTGTCCCAGCCGAGGCCCAGAGG - Intergenic
1179741111 21:43418449-43418471 CTCTGCGAGCAAAAGCCCCGCGG - Exonic
1180935211 22:19620868-19620890 CTCTCCCAGCAGAAGCGCATGGG + Intergenic
1181049514 22:20231916-20231938 CTGAGCCAGCAGGAGGCCAAGGG - Intergenic
1181816156 22:25438148-25438170 CTCTGCCAGCTGGAGGCCAGTGG + Intergenic
1182049581 22:27302535-27302557 CTGTGGCCTCTGAAGCCCAGAGG + Intergenic
1182118962 22:27774700-27774722 TCGTGCCCGCAGAACCCCAGGGG + Intronic
1182546884 22:31081666-31081688 CTGTGGCGGCAGAAACCCTGGGG + Intronic
1183049087 22:35246198-35246220 CTGTGCCAGCAAAGGCTGAGTGG - Intergenic
1183075219 22:35422572-35422594 CTGTGCCTGCAGCATCCCAGAGG - Intronic
1183248067 22:36709292-36709314 CTGTGCCATCAGAAGGCCCTCGG + Intergenic
1183319247 22:37155134-37155156 GTACGCCAGCAGAAGCCCAGAGG + Intronic
1183395158 22:37567281-37567303 CAGTGCCAGGAGAGGCGCAGGGG + Intronic
1183410839 22:37654220-37654242 CCGTCCCTCCAGAAGCCCAGAGG + Intronic
1184074036 22:42164853-42164875 CTGTGTGTGCAGAAGCCCAGAGG + Intronic
1184558784 22:45248952-45248974 CTGTGCTAGCAGAAGTCAAAAGG - Intergenic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
1184724728 22:46336902-46336924 CAGTGCAAGCAGAATCACAGAGG + Intronic
950590829 3:13934910-13934932 CTGTGCCAGGACAGACCCAGCGG + Intergenic
951172054 3:19554199-19554221 CTGATCCAGCACAATCCCAGTGG - Intergenic
951793358 3:26510924-26510946 CACTGCCAGAAAAAGCCCAGGGG + Intergenic
953434727 3:42869425-42869447 CTATGCCATCAAAAGCTCAGGGG - Intronic
954611151 3:51945187-51945209 CTTGGCCTGCAGAAGCTCAGGGG - Exonic
954684732 3:52364361-52364383 CTGTCCCAGCACATGGCCAGGGG - Intronic
955298207 3:57753185-57753207 CTGTGCCTGCTGAATACCAGTGG + Intergenic
955865786 3:63382401-63382423 CTGTGCCAGCAAAGGTCAAGTGG - Intronic
956470337 3:69559916-69559938 GAGTGTCATCAGAAGCCCAGAGG - Intergenic
959578117 3:107957023-107957045 TTGTACCAGCCGGAGCCCAGAGG + Intergenic
959841745 3:110984278-110984300 CTGACCCAGCAGAGGCCTAGTGG + Intergenic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
962410514 3:135137539-135137561 CTCTGCCACCATGAGCCCAGAGG - Intronic
962619440 3:137162660-137162682 CTGTCCCACCACAAGCCCTGAGG - Intergenic
963121219 3:141778459-141778481 CTGTGTGAGCAGCAGCCCATCGG + Exonic
963273032 3:143303975-143303997 CTGTGCCAGTAAATGTCCAGTGG - Intronic
964158113 3:153611682-153611704 CTTTGTCAGAAGAAGCCCAATGG + Intergenic
968064152 3:195748914-195748936 CAGTGCCAGCACCTGCCCAGTGG - Exonic
968481513 4:835083-835105 CTGTGGCTGCTGGAGCCCAGGGG - Intergenic
968733068 4:2280778-2280800 CTGTGAAAGGAGAAGCCCATGGG + Intronic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
969256886 4:6008293-6008315 CTGGGCCAGCAGGAGGCCCGCGG + Intergenic
969373012 4:6746275-6746297 ATGTCCCAGGAGAAGCCCTGAGG + Intergenic
969475116 4:7417937-7417959 GTGAGCCAGCAGAAGGCTAGAGG + Intronic
969757888 4:9161993-9162015 CTGTCCCTGCAGAACTCCAGTGG + Intergenic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
972639042 4:40909072-40909094 CTGTGACAGGGGAGGCCCAGAGG - Intronic
972801803 4:42483558-42483580 TGGTGCCTGGAGAAGCCCAGAGG + Intronic
973158380 4:46986759-46986781 CTGTGCCAGAAGTAGACCAGGGG - Intronic
976453835 4:85223028-85223050 CTGACCCAGCACAATCCCAGTGG - Intergenic
976635938 4:87286614-87286636 CCCTGCCATCATAAGCCCAGAGG + Intergenic
977417326 4:96749579-96749601 CTGTCCCAGCACAAGCCCAGAGG - Intergenic
978520418 4:109609696-109609718 CTGAGCCAGCACAGTCCCAGTGG - Intronic
982854411 4:160362700-160362722 CTGTCCCATCAAAAGCCCAGAGG - Intergenic
983020508 4:162670206-162670228 CTGTCCCATCATAGGCCCAGAGG - Intergenic
986093749 5:4536193-4536215 CTGCACCAGCAGAAGCCAGGAGG + Intergenic
987909443 5:24122588-24122610 CTCTGCCATCACAGGCCCAGAGG - Intronic
989285249 5:39691863-39691885 CTGTAGCATCAGAAGCCTAGTGG - Intergenic
989631052 5:43483492-43483514 CTGGGCCAGAAAAAGGCCAGGGG + Intronic
989696878 5:44212266-44212288 CTCTCCCATCACAAGCCCAGAGG + Intergenic
990305638 5:54492048-54492070 CCTTCCCAGCAGCAGCCCAGGGG - Intergenic
991209041 5:64083833-64083855 CTGACCCAGCACAATCCCAGTGG - Intergenic
991494643 5:67215235-67215257 CTGTGCCAACAGAGATCCAGGGG - Intergenic
992371955 5:76152738-76152760 CTGATCCAGCAGAAACCCACAGG - Intronic
992622989 5:78611578-78611600 CTGGGGCAGAAGGAGCCCAGAGG + Intronic
993506374 5:88714023-88714045 CTGTGCCTGGAGAATCCTAGAGG + Intergenic
997359179 5:133283561-133283583 CTGGGGCAGCAGATCCCCAGGGG + Intronic
998744288 5:145239425-145239447 CTGGGTCAGCAGAGGCCCAGAGG + Intergenic
999948142 5:156619644-156619666 CTTTTCCAGCAGAGGCCAAGGGG + Intronic
1001711975 5:173786373-173786395 CAGTGGCAGCAGAAGGCCAAGGG - Intergenic
1002181206 5:177432012-177432034 CTGTGCGAGCGGCAGCCCATTGG + Exonic
1002292416 5:178209037-178209059 CTGGGCCAACTGCAGCCCAGGGG - Intronic
1002679965 5:180953683-180953705 CTGTTCCAGAACAAGCACAGTGG - Intergenic
1003230081 6:4243769-4243791 CTCTCCCATCAGAGGCCCAGAGG - Intergenic
1004162787 6:13229600-13229622 CTGTGTCTGCAGAAGTTCAGCGG - Intronic
1004590613 6:17047697-17047719 CTGTGACAACAGAAGGACAGCGG + Intergenic
1004869386 6:19889419-19889441 ATTTGCTACCAGAAGCCCAGGGG - Intergenic
1005465584 6:26109339-26109361 CTGTTCCAGTAGAAGCTCAGGGG - Intergenic
1006062922 6:31439027-31439049 CTCTCCCATCACAAGCCCAGAGG + Intergenic
1006651729 6:35557282-35557304 CTGTGCCAGCCGAAGGGCTGGGG - Intergenic
1007851245 6:44804606-44804628 GTGTGCTTGCAGAAGCCCTGGGG - Intergenic
1008251951 6:49251062-49251084 CTGAGGCAGGAGAATCCCAGTGG + Intergenic
1008678393 6:53845500-53845522 CTGGGGCAACAGAAGACCAGAGG - Intronic
1011693127 6:89887921-89887943 CTGTGCCACCCGCGGCCCAGTGG + Intergenic
1017725800 6:157275131-157275153 CAGTGCCGGCCGAAGCCCGGTGG + Intergenic
1018981268 6:168603426-168603448 CTGTCCCAGCAGCTTCCCAGGGG - Intronic
1019578602 7:1749359-1749381 CCCTTACAGCAGAAGCCCAGGGG + Intergenic
1019605928 7:1910219-1910241 CTTCGGCAGCAGAGGCCCAGCGG + Intronic
1020132951 7:5569889-5569911 CTTTGCCAGCAGGAAACCAGTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022223545 7:28339911-28339933 CTGTGCCACCACAGGCCCACGGG + Intronic
1022650434 7:32269063-32269085 CTGTGGCAGTAGCAGCACAGAGG + Intronic
1024620990 7:51157498-51157520 CTGTCCCATCAGCAGACCAGGGG - Intronic
1032699077 7:134363006-134363028 CTGGGCAAGCAGAAGCAAAGCGG - Intergenic
1032704187 7:134407873-134407895 CTGACCCAGCAGATGCCCCGTGG - Intergenic
1032772755 7:135075918-135075940 CCATGCCAACACAAGCCCAGTGG - Intronic
1033278153 7:139988076-139988098 CTGTCCCAGCAGGACGCCAGGGG + Intronic
1033768139 7:144517295-144517317 CTTTGGCAGCAGATGGCCAGAGG + Intronic
1034440700 7:151084320-151084342 CTGTGGCTACAGGAGCCCAGAGG - Intergenic
1034881679 7:154767582-154767604 CAGTGCCAATAGAAGCTCAGAGG - Intronic
1037078557 8:14753880-14753902 CTGTGGTAGCAGAAGACCATAGG + Intronic
1038084560 8:24180354-24180376 CTGTTCCAGCAGAGGTCTAGGGG + Intergenic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1042225487 8:66511692-66511714 CAGTGACAGCAGGAGTCCAGAGG + Intronic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044515260 8:93130229-93130251 CGATGCCAGCTGAAACCCAGAGG + Intergenic
1045272107 8:100670826-100670848 CTCTGCCAGCAGAGGCCAGGAGG - Intergenic
1045781374 8:105867409-105867431 TTGTGCCAGCAGGAGTCCTGAGG + Intergenic
1048259892 8:132936641-132936663 ACGTGCCAGCAGCGGCCCAGAGG - Intronic
1048284930 8:133134244-133134266 CTGAGTGAGCAGGAGCCCAGAGG + Intronic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049212402 8:141392718-141392740 CTGGGCCACCAGCTGCCCAGGGG - Intronic
1049403313 8:142440565-142440587 CTGTGCCAGCAGGGCCTCAGCGG - Intergenic
1049428078 8:142546142-142546164 GTGTGTCTGCAGTAGCCCAGAGG + Intergenic
1050221623 9:3397445-3397467 CTGTGACAACAGATGCCAAGAGG - Intronic
1050626555 9:7510294-7510316 CTGTGGAACCAGAAGACCAGGGG - Intergenic
1052701293 9:31941207-31941229 CTCTGTCATCAGAGGCCCAGAGG + Intergenic
1056059613 9:82870494-82870516 CTGTGACCCCCGAAGCCCAGAGG - Intergenic
1056419596 9:86410625-86410647 CTATGCCAGCACAGGTCCAGGGG - Intergenic
1057010917 9:91600597-91600619 ATTTTCCAGCAGAAGCCGAGGGG - Intronic
1057421759 9:94918461-94918483 CTGTGCCAGCTCAAGCCCATGGG - Intronic
1059173373 9:112147405-112147427 CTGAGACAGGAGAAGCACAGGGG + Intronic
1059522246 9:114954194-114954216 GTGTGCCTGCAGAAGCCCTCAGG - Intergenic
1060394337 9:123305086-123305108 ATGAGGCAGCAGAAGCACAGAGG + Intergenic
1062156143 9:135049739-135049761 CTGTGGCTGCTGAGGCCCAGGGG - Intergenic
1062229840 9:135475844-135475866 CCCTTCCAGCAGAGGCCCAGAGG + Intergenic
1062623889 9:137434440-137434462 CTGGCCCAGCAGAAGCCCCCAGG + Exonic
1186539992 X:10390691-10390713 CTGACCCTGCTGAAGCCCAGAGG - Intergenic
1186708877 X:12172018-12172040 CTGTGCCAGCAGAAATTCAAGGG - Intronic
1186797697 X:13062546-13062568 CTCTACCATCACAAGCCCAGAGG - Intergenic
1187056237 X:15743765-15743787 CTGGCCAAGCAGATGCCCAGGGG - Intronic
1189637247 X:43023832-43023854 CCCTCCCATCAGAAGCCCAGAGG - Intergenic
1190234113 X:48602917-48602939 CTGTGGCAGGAGGAGGCCAGAGG - Intronic
1191656514 X:63604733-63604755 CTCTGCCATCAGAGACCCAGAGG + Intergenic
1193421867 X:81292483-81292505 CCCTGCCATCAAAAGCCCAGAGG - Intronic
1193529644 X:82641694-82641716 CTGACCCAGCAGAGTCCCAGTGG - Intergenic
1193584663 X:83306351-83306373 CTGTGCCAGAAGCAGCCCCATGG + Intergenic
1193765737 X:85527541-85527563 CTGACCCAGCACATGCCCAGTGG - Intergenic
1194066542 X:89268380-89268402 CAGAGCCAGTAGAAGCCCAGTGG - Intergenic
1194892201 X:99394277-99394299 CTGTCCCAGCACAGTCCCAGTGG - Intergenic
1195782929 X:108484723-108484745 CTGACCCAGCACAATCCCAGGGG - Intronic
1196693911 X:118590761-118590783 CTGGGCCACCAGAATCCCACTGG + Intronic
1197146840 X:123181418-123181440 CTGAGCCAGCAGGGGCACAGTGG - Intergenic
1197172496 X:123449943-123449965 GTGTGCCAGAAGAATACCAGAGG - Intronic
1197177820 X:123503699-123503721 CTCCACCACCAGAAGCCCAGGGG + Intergenic
1197748947 X:129952108-129952130 CTGTGCTAGCAAAATGCCAGAGG - Intergenic
1198667964 X:139045321-139045343 CTGTCCCATCACAGGCCCAGAGG - Intronic
1199310100 X:146311691-146311713 CTCTGCCATCACAGGCCCAGAGG - Intergenic
1200135921 X:153874621-153874643 CTGTGCCAGCAGTGGGACAGGGG - Intronic
1200151501 X:153953592-153953614 CTGTGCCGGTAAGAGCCCAGGGG - Exonic
1200720710 Y:6602501-6602523 CAGAGCCAGTAGAAGCCCAGTGG - Intergenic