ID: 1097691171

View in Genome Browser
Species Human (GRCh38)
Location 12:62735898-62735920
Sequence GAGAACTACCTTCCATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 251}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097691171_1097691176 2 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691176 12:62735923-62735945 TGGCTGGAGCATGGGATGCCTGG 0: 1
1: 0
2: 2
3: 51
4: 446
1097691171_1097691175 -6 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691175 12:62735915-62735937 GTTCTCTGTGGCTGGAGCATGGG 0: 1
1: 1
2: 5
3: 33
4: 342
1097691171_1097691182 20 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691182 12:62735941-62735963 CCTGGTGGCAGTGGTGGTGGTGG 0: 1
1: 5
2: 98
3: 580
4: 4909
1097691171_1097691177 5 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691177 12:62735926-62735948 CTGGAGCATGGGATGCCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 321
1097691171_1097691179 14 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691179 12:62735935-62735957 GGGATGCCTGGTGGCAGTGGTGG 0: 1
1: 0
2: 4
3: 45
4: 465
1097691171_1097691174 -7 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691174 12:62735914-62735936 AGTTCTCTGTGGCTGGAGCATGG 0: 1
1: 1
2: 8
3: 64
4: 372
1097691171_1097691178 11 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691178 12:62735932-62735954 CATGGGATGCCTGGTGGCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 362
1097691171_1097691180 17 Left 1097691171 12:62735898-62735920 CCTGGAAATGGAAGGTAGTTCTC 0: 1
1: 0
2: 1
3: 28
4: 251
Right 1097691180 12:62735938-62735960 ATGCCTGGTGGCAGTGGTGGTGG 0: 1
1: 0
2: 4
3: 82
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097691171 Original CRISPR GAGAACTACCTTCCATTTCC AGG (reversed) Intronic
901624512 1:10616337-10616359 CAGAGGTACCTTCCATGTCCTGG - Intronic
903557098 1:24202081-24202103 GAAAACTGCCTCCCACTTCCTGG - Intergenic
904293310 1:29501550-29501572 GAGAATTCCTTTCCCTTTCCAGG - Intergenic
906184083 1:43847449-43847471 CAGAATTTCCTTCCATTTTCAGG - Intronic
908239617 1:62177769-62177791 GAGAATCACCTTCCCTTTCCAGG + Intergenic
908662108 1:66447973-66447995 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
909474106 1:76062838-76062860 GAGAACTCCTTTCCCTTTCCAGG - Intergenic
909881859 1:80889737-80889759 CAGAATTACCTACCATTCCCTGG - Intergenic
911341566 1:96644825-96644847 GAAAACTACCATACATTGCCTGG + Intergenic
911407637 1:97462784-97462806 GAGAATCCCCTTCCTTTTCCAGG + Intronic
911460660 1:98185635-98185657 CAGAGCTAACTTCCATTTACAGG + Intergenic
912922319 1:113881262-113881284 GAGCACTCCTTTCCATTTACAGG - Intronic
913173610 1:116254457-116254479 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
913477057 1:119248054-119248076 CAGAGCTACCTTCCATTCTCTGG + Intergenic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
915642714 1:157241585-157241607 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
917240782 1:172946260-172946282 GTTAATTTCCTTCCATTTCCAGG + Intergenic
917543017 1:175933909-175933931 GAGCACCACATTCCATTTCTAGG + Intergenic
918338903 1:183550924-183550946 GAGATCTACATTTCATTGCCAGG + Intronic
919353533 1:196491744-196491766 GAGATCTACCCTACACTTCCTGG + Intronic
919358708 1:196562114-196562136 GAGAATTCCATTCCCTTTCCAGG - Intronic
920557786 1:206916629-206916651 GAGAACTAGTTTCTTTTTCCTGG - Intronic
920939977 1:210473075-210473097 GAGAATCCCCTTCCCTTTCCAGG - Intronic
922047941 1:221964935-221964957 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
922073181 1:222216507-222216529 AAGAACTCCCTTACATTTCCAGG + Intergenic
922166534 1:223120152-223120174 GAGAATCCCCTTCCCTTTCCAGG + Intronic
923074802 1:230600915-230600937 GAGAAGCACCTTCCCTTTCTAGG - Intergenic
923556670 1:235006339-235006361 GAGAATTTCCTTCCTTTTCAAGG - Intergenic
924055138 1:240117675-240117697 GAGAACTACCTTCTACTTTTAGG - Intronic
1063102707 10:2964287-2964309 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1064184847 10:13152714-13152736 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1064359325 10:14649357-14649379 GAGAATTCCCTTTCCTTTCCAGG + Intronic
1064520234 10:16193307-16193329 GAGAACACCCTTCCCTTTCCAGG + Intergenic
1065793669 10:29285072-29285094 GAGAATTAAGCTCCATTTCCTGG + Intergenic
1065949018 10:30634705-30634727 GAGAATTAAACTCCATTTCCTGG - Intergenic
1066778967 10:38921879-38921901 GTGGACTACCTTGCCTTTCCTGG - Intergenic
1067399253 10:45955985-45956007 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1067790698 10:49285322-49285344 CAGAACTTCCTTCCTTTTACAGG - Intergenic
1067867572 10:49925201-49925223 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1068483636 10:57628068-57628090 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1069248741 10:66243299-66243321 GAGAATTCTCTTCCCTTTCCAGG + Intronic
1071036402 10:81251872-81251894 GAAAACCCCCTTCCCTTTCCAGG + Intergenic
1073541654 10:104320180-104320202 CAGAATTTCCTTCCCTTTCCAGG + Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1077084800 11:744148-744170 AAAAACTACTTTCCATATCCAGG + Intergenic
1077084811 11:744210-744232 AAAAACTACCTTCCACTTCTAGG + Intergenic
1082838098 11:57666622-57666644 GAGAACTACCTTCTGTTTTCTGG - Intergenic
1084025871 11:66449106-66449128 GAGAATCTCCTTCCTTTTCCGGG + Intronic
1085881568 11:80473493-80473515 AAGATCTACGTGCCATTTCCTGG - Intergenic
1086751954 11:90507410-90507432 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1088168651 11:106968868-106968890 GAGACCAAACTTCCAATTCCTGG - Intronic
1088434263 11:109793625-109793647 CAGAACTTCCTTCCTTTTCAAGG - Intergenic
1088786722 11:113188983-113189005 GAAAACTTCCTTCCATCTTCAGG - Intronic
1091488017 12:908478-908500 GAGAACTTCCTTGCCATTCCAGG - Exonic
1094657112 12:32431013-32431035 GAGAGCTAATGTCCATTTCCAGG + Intronic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1097994378 12:65871673-65871695 GAGAACTACATTCCTTTCCTAGG + Intronic
1100424842 12:94474808-94474830 GGGACCTTCCTTGCATTTCCTGG + Intergenic
1101469194 12:104979641-104979663 TAAAACAACCTTCCATTTCTTGG + Intergenic
1104347901 12:128019150-128019172 GAGACCTGCCTCCGATTTCCGGG + Intergenic
1104355353 12:128080393-128080415 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1104530578 12:129566679-129566701 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1105594173 13:21820476-21820498 TGGAACTAACTTCCATTTCCAGG - Intergenic
1106397428 13:29394611-29394633 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1108063337 13:46553635-46553657 GGGAAATTCCTTCAATTTCCTGG - Exonic
1108114424 13:47111258-47111280 GAGAATTACCTTCCGTGTTCCGG - Intergenic
1108272037 13:48771166-48771188 GAGGTCTTCCTTCCTTTTCCAGG + Intergenic
1109172649 13:59115688-59115710 GAGTGCTACTTTTCATTTCCAGG - Intergenic
1109342539 13:61079449-61079471 GAGAACCCCCTTCCCTTTCCAGG + Intergenic
1109486723 13:63032679-63032701 CAGAACTTCATTCCATTTTCTGG + Intergenic
1109596087 13:64555790-64555812 GAGAATTTCCTTCCATTTTGTGG + Intergenic
1110757555 13:79193407-79193429 CAGAACTTCCTTCCTTTTCAAGG - Intergenic
1112023562 13:95392570-95392592 GAGAATTATCTCCCATTTCTGGG + Intergenic
1113971830 13:114197166-114197188 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1115875460 14:37856765-37856787 CATAACTACCTTCCATATCCTGG - Intronic
1116118905 14:40695655-40695677 GAGAATCACCTTCTTTTTCCAGG - Intergenic
1116129388 14:40835180-40835202 GAGAAATTCATTCCATTTCCAGG + Intergenic
1117969424 14:61237415-61237437 GAGAACTCCTTTCCCTTTCCAGG + Intronic
1118105770 14:62657756-62657778 GAGAACCCACTTCCCTTTCCAGG + Intergenic
1118107899 14:62681379-62681401 GAGAACTTCCTTCTATTTCCTGG - Intergenic
1118800275 14:69183460-69183482 AAGAACTACCTACCCTCTCCAGG + Intergenic
1120159460 14:81130054-81130076 AAGAACTACCTTGCCTTTCTTGG + Intronic
1121058428 14:90880446-90880468 GAGAACTTCCTCCCTTTTCAAGG + Intronic
1121424994 14:93844088-93844110 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123159228 14:106261519-106261541 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123160342 14:106272389-106272411 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123207999 14:106732133-106732155 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1123780043 15:23617301-23617323 AAGAACTTCCTACAATTTCCAGG - Intronic
1124022573 15:25938178-25938200 CAGAACTCCCTTCTGTTTCCAGG + Intergenic
1124898655 15:33801419-33801441 GAGAATCCCCTTCCCTTTCCTGG - Intronic
1128475898 15:67996639-67996661 AACAACTCCCTTCTATTTCCTGG + Intergenic
1129669170 15:77597657-77597679 TGGAACTACCCTCCATTGCCCGG - Intergenic
1131093779 15:89642994-89643016 TAGAACTAACTTTCATTTCCAGG + Intronic
1133291971 16:4728369-4728391 GGCAACTACCTTCCATTGCCTGG + Intronic
1133453852 16:5925321-5925343 GAGAACTTCATTCCTTTTCAAGG - Intergenic
1134001886 16:10789261-10789283 GAGAACCCCCTTCCCTTTCCAGG - Intronic
1135027399 16:19009260-19009282 GAGAACGACTGTCCATTCCCGGG + Exonic
1138261701 16:55628148-55628170 GAGAATTCTCTTCCCTTTCCAGG - Intergenic
1140782400 16:78308622-78308644 GAGAACATCCTTCCCTTTCCAGG + Intronic
1141411872 16:83840548-83840570 GAGAATTCCCCTCCCTTTCCAGG - Intergenic
1144144077 17:12380534-12380556 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1145021823 17:19437878-19437900 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1145356160 17:22154804-22154826 CAGAACTTCATTCCATTTTCTGG - Intergenic
1145829329 17:27902589-27902611 AATAACTCCCATCCATTTCCTGG - Intergenic
1145904373 17:28508135-28508157 GAGAACTCCCTGGCATTCCCGGG - Intronic
1146503361 17:33383417-33383439 GGGAAGTACCTTCCACTCCCAGG - Intronic
1148258998 17:46162887-46162909 GTCAAGCACCTTCCATTTCCAGG + Intronic
1148951818 17:51319921-51319943 GAGAATCCCCTTCCCTTTCCTGG - Intergenic
1149252541 17:54786931-54786953 GTGAACTACAATTCATTTCCTGG + Intergenic
1150454720 17:65298072-65298094 CAGAACAACCTTCCCATTCCAGG + Intergenic
1150659187 17:67060760-67060782 CAGAACTCCCTTCCTTTTTCAGG + Intergenic
1150698087 17:67423331-67423353 GAGAAATACTCTCCATTGCCTGG + Intronic
1153024792 18:662332-662354 GAACAATGCCTTCCATTTCCCGG + Intronic
1154113513 18:11590809-11590831 GAGGAATCCCTTCCCTTTCCAGG - Intergenic
1155283007 18:24259893-24259915 AAATACTTCCTTCCATTTCCTGG - Intronic
1155850514 18:30768757-30768779 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1156053181 18:32963688-32963710 GAGAACGGCCTTCCATTCTCAGG + Intronic
1156185684 18:34660536-34660558 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1157876867 18:51281827-51281849 GAGAATCTCCTTCCCTTTCCAGG - Intergenic
1159476837 18:68931770-68931792 GAGAGGTACCTGCCACTTCCAGG - Intronic
1159677674 18:71305971-71305993 GAGAATCTCCTTCCATTTGCAGG - Intergenic
1163564697 19:18043958-18043980 GAGAAATACCTTCCTGCTCCTGG + Intergenic
1164616594 19:29670451-29670473 CAGAATTACCTTCCTTTTCGAGG + Intronic
925455420 2:4012450-4012472 TGGAACTACCTTCCACCTCCAGG - Intergenic
926114787 2:10205571-10205593 GAGAGATACCTTCCGTTTCAAGG + Intronic
928604797 2:32935806-32935828 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
930023594 2:47016083-47016105 CAGGACTGCCTTCCATTTCAAGG - Intronic
930285480 2:49422649-49422671 GAGAATTCTCTTCCCTTTCCAGG + Intergenic
931455766 2:62408754-62408776 GGGAAGTACCTTCAATTTGCTGG - Intergenic
931969000 2:67565394-67565416 AAGAACCAGCATCCATTTCCAGG - Intergenic
932336446 2:70934259-70934281 GAGAAGTTCCTTCCATTGGCAGG + Intergenic
934940237 2:98495859-98495881 GAGAATCCCCTTCCCTTTCCAGG - Intronic
935168386 2:100589771-100589793 GTGAACTGCCCTCCACTTCCGGG + Intergenic
936711739 2:115139687-115139709 TAGATCTACCTTCCAATTGCAGG - Intronic
936935079 2:117831996-117832018 AAGAACAATCTTCCATTTCTGGG + Exonic
938298292 2:130192173-130192195 GAGAAGTAGCTACCATTTCTAGG - Intronic
938661833 2:133494867-133494889 GAGAATCCCCTTCCCTTTCCAGG + Intronic
938755159 2:134372705-134372727 GAAAACTACTCTCCATTCCCAGG - Intronic
941278656 2:163522438-163522460 CAGAACTACATTCCCTTTACTGG - Intergenic
941942650 2:171059488-171059510 AAGAACTTAATTCCATTTCCAGG + Intronic
941982451 2:171473880-171473902 GAGAACAACAATCCATTTCTTGG - Exonic
942605055 2:177681968-177681990 GAGAATCCCCTTCCCTTTCCAGG + Intronic
942936378 2:181561620-181561642 GAGAATCTCCTTCCCTTTCCAGG + Intronic
944301444 2:198129184-198129206 GAGAAGCCCCTTCCCTTTCCAGG + Intronic
944529042 2:200649673-200649695 GACAACGACCTTCCCCTTCCTGG + Intronic
944568386 2:201015766-201015788 CAGAACTACTTTCTATTTCCAGG + Intronic
944720528 2:202418858-202418880 GAGAATCCCCTTCCCTTTCCAGG - Intronic
947051147 2:226044967-226044989 GAGAACCACCCACCATCTCCAGG + Intergenic
947226111 2:227841938-227841960 GAGAATTCCCTTCCCTTTCTAGG - Intergenic
947814731 2:233028952-233028974 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
947995859 2:234526592-234526614 GAGAATTACTATCCATCTCCTGG + Intergenic
1170724173 20:18911309-18911331 GAGAATTCCCTTTCCTTTCCAGG + Intergenic
1171494454 20:25545819-25545841 GAGAATCTCCTTCCTTTTCCAGG + Intronic
1172566880 20:35937658-35937680 GAGAACCTCCTTTCCTTTCCAGG - Intronic
1172922366 20:38495885-38495907 TAGGTCTACCTACCATTTCCAGG - Intronic
1173746469 20:45441207-45441229 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175181348 20:57149853-57149875 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175586769 20:60147342-60147364 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1175618806 20:60425823-60425845 AAGAACAATCTTCCATTTCTGGG - Intergenic
1175633509 20:60561312-60561334 AAGAAGTGCCTTCCATCTCCAGG + Intergenic
1175662428 20:60825351-60825373 GGGAACTAACCTCCATATCCTGG + Intergenic
1177403103 21:20631734-20631756 GAGAACAGCCTCCCATTTCCTGG - Intergenic
1177649492 21:23942013-23942035 GAGAATTTCCTTCCCTTTCCAGG + Intergenic
1177801749 21:25834833-25834855 GAGAATCACTTTCCTTTTCCAGG + Intergenic
1178247492 21:30968009-30968031 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1182793132 22:32969601-32969623 GAGCACTAGCTTTCATCTCCTGG - Intronic
1183103100 22:35595986-35596008 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1184520397 22:44990478-44990500 CAGAACTTCCTTCCTTTTTCAGG - Intronic
1184902269 22:47453854-47453876 AAGAAGTCACTTCCATTTCCTGG - Intergenic
1184911408 22:47537077-47537099 CAGAACTTCCTTCCTTTTCAGGG + Intergenic
950478931 3:13232808-13232830 CAGAATTCCCTTCCATTTCATGG - Intergenic
951857476 3:27213885-27213907 GAGAATCTCCTTCCCTTTCCAGG + Intronic
952853715 3:37750557-37750579 GAGAACTCACCACCATTTCCTGG - Exonic
953048466 3:39317105-39317127 GAGAATCCCCTTCCCTTTCCTGG + Intergenic
953216865 3:40926936-40926958 GTTAACTCCCTTGCATTTCCAGG + Intergenic
953424066 3:42778623-42778645 CAGAACTTACTTCCATTACCAGG - Intronic
954867640 3:53743531-53743553 GAGAACTTCCTTTGATTTTCAGG + Intronic
954969764 3:54641535-54641557 GAGAATTTCCTTCCCTTTCTAGG - Intronic
955381492 3:58441969-58441991 GAGAATCCCCTTCCTTTTCCAGG - Intergenic
955909793 3:63848170-63848192 GAGAATCCCCTTCCCTTTCCAGG + Intronic
957492037 3:80940127-80940149 GAGAAGTCACCTCCATTTCCAGG - Intergenic
957773774 3:84729027-84729049 GAGAATCCCCTTCCATTTCCAGG + Intergenic
959082017 3:101812266-101812288 GACAACTACTTTCCAATTACTGG + Intronic
959809495 3:110598893-110598915 GAGAATGCCCTTCCCTTTCCAGG + Intergenic
961613325 3:128159068-128159090 GAGACCCACCTTCCTTTTCAGGG + Intronic
962182816 3:133226316-133226338 GAGAATTCCCTTGCCTTTCCAGG - Intronic
965119747 3:164539248-164539270 GAAAACTGCCTTGCTTTTCCAGG + Intergenic
965514058 3:169601663-169601685 CAGAACAACCTTCCATCTGCAGG + Intronic
966754320 3:183354326-183354348 GAGAATCCCCTTCCCTTTCCAGG + Intronic
967696733 3:192541677-192541699 AAGAACTCCCTTACATTTCTTGG + Intronic
967826456 3:193881561-193881583 GACACCTTCCTTCCATTGCCTGG + Intergenic
968939573 4:3630968-3630990 GAAAATCACCTCCCATTTCCGGG - Intergenic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
969258360 4:6018290-6018312 CAGCACTATCTTCCATGTCCTGG + Intergenic
969652052 4:8473849-8473871 GGGAGCTACCTGCCATGTCCAGG + Intronic
971239349 4:24873580-24873602 GAGAACTTCCTTTAATTTCCTGG - Intronic
971609216 4:28700509-28700531 GAGAAATACGTGCCCTTTCCAGG - Intergenic
972699463 4:41480224-41480246 CAGATCTACATTCCAATTCCAGG - Intronic
973574092 4:52268445-52268467 GAGAATTCCCTTCCCTTTCTAGG + Intergenic
974488103 4:62529656-62529678 GAGAATTTCTTTCCTTTTCCAGG - Intergenic
976696062 4:87920893-87920915 GAGAATCCCCTTCCATTTCCAGG + Intergenic
978080716 4:104588084-104588106 GTGCTCTACCTTCCATGTCCTGG + Intergenic
979834628 4:125348914-125348936 GAAAACTAACTTCTATTTTCAGG - Intronic
980908782 4:138975270-138975292 GAGAATTCCCTTCCCTTTCCAGG + Intergenic
981069091 4:140516213-140516235 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
981692318 4:147523248-147523270 GATTATTCCCTTCCATTTCCAGG - Intronic
981903291 4:149891279-149891301 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
982009471 4:151092849-151092871 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
982415029 4:155120978-155121000 GAGAATTCCTTTCCATTTCCAGG + Intergenic
983273719 4:165592562-165592584 GACAAATACTTTCCATTTTCTGG - Intergenic
984539616 4:181021506-181021528 GGGAAGTAACTTTCATTTCCAGG - Intergenic
985575838 5:673197-673219 GAGATTTTCCTTCGATTTCCGGG - Intronic
986689546 5:10302892-10302914 GAGAATCCCCTTCCCTTTCCAGG + Intronic
987265806 5:16253755-16253777 GAGAATTCCCTTCTCTTTCCAGG - Intergenic
987586152 5:19859474-19859496 GAGAATCTCCTTCCCTTTCCAGG + Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988799811 5:34685836-34685858 GATAATTACATTCCATTTCCAGG + Intronic
989003113 5:36782185-36782207 GAGAACTTCCTTCTGTTTCTTGG - Intergenic
989477495 5:41891051-41891073 GAAAATTCCCTTCCCTTTCCAGG + Intergenic
990576398 5:57127627-57127649 CAGAACTAAATTCCATTTCTGGG + Intergenic
991314272 5:65282511-65282533 GAGAATCCCCTTCCCTTTCCAGG - Intronic
991523766 5:67532324-67532346 GGGAACAACCCTCAATTTCCTGG - Intergenic
991938631 5:71828344-71828366 GAGAACTACCTCCTGTCTCCAGG + Intergenic
994131583 5:96235356-96235378 AACAACTACTTTCCATTCCCTGG + Intergenic
995192453 5:109331938-109331960 GAGAACTTCCTACCTTTGCCTGG - Intergenic
995301846 5:110594207-110594229 GGGAACTACCTTCCCTAGCCAGG + Intronic
999415089 5:151388067-151388089 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
999829321 5:155303880-155303902 GAGTAGTAGCTTCCAGTTCCTGG - Intergenic
999870128 5:155741335-155741357 GAGAATTCCCTTCTTTTTCCAGG - Intergenic
1001076989 5:168637209-168637231 GAGAAGCCCCTTCCCTTTCCAGG - Intergenic
1003026796 6:2562200-2562222 GAAACCTACCTACCATTCCCTGG - Intergenic
1008649891 6:53551426-53551448 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1010803655 6:80209140-80209162 GATAATTATCTTCCATTTCTAGG - Intronic
1011490961 6:87891522-87891544 GAGAAATACCTTCCCTCTCATGG + Intergenic
1015681667 6:135815215-135815237 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1015751951 6:136569279-136569301 GAGAATCCCCTTCCCTTTCCAGG + Intronic
1016490727 6:144598545-144598567 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1016498226 6:144689159-144689181 GAGAAGTACCTTCCAGGTTCAGG - Intronic
1017407361 6:154134722-154134744 GAGAACTATCTGCAATTTGCAGG - Intronic
1018555695 6:165048802-165048824 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1019068475 6:169322381-169322403 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1023025618 7:36047370-36047392 GAGAAGTAGCTTCCAGTTCAGGG + Intergenic
1023308634 7:38858150-38858172 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1023536807 7:41222111-41222133 GAGAACTACCTGAAATTTACAGG - Intergenic
1025005919 7:55354736-55354758 GGGAATCCCCTTCCATTTCCAGG + Intergenic
1026301972 7:69105978-69106000 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1027362939 7:77428270-77428292 GAAAACTAACTTCTATTTCCTGG + Intergenic
1028614211 7:92747086-92747108 GAGATATACCTTCCTATTCCAGG + Intronic
1029355421 7:100048300-100048322 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1029955024 7:104629531-104629553 GCTAACCAGCTTCCATTTCCGGG - Intronic
1030223405 7:107122585-107122607 AATTACTACTTTCCATTTCCAGG - Intronic
1032674280 7:134114128-134114150 GAGAATCCCCTTCCATTTCCAGG + Intergenic
1034060114 7:148079576-148079598 GAGAATCCCTTTCCATTTCCAGG - Intronic
1034311951 7:150096378-150096400 GAGAAGCACCTGCTATTTCCTGG - Intergenic
1041735630 8:61107654-61107676 GAGAACCAGCTGCCATCTCCAGG - Intronic
1042820331 8:72923290-72923312 GAGAATTCCTTTCCATTTCTAGG - Intronic
1045332437 8:101167088-101167110 AAGAACTGGGTTCCATTTCCTGG + Intergenic
1048281527 8:133109072-133109094 CAGAACTACCTTGTAGTTCCAGG - Intronic
1048357360 8:133664490-133664512 GAGAACCAGCTTGCCTTTCCAGG - Intergenic
1048777969 8:137968410-137968432 GAGAATCCCCTTCCCTTTCCGGG + Intergenic
1049730052 8:144172184-144172206 GAGAATCTCCTTCCGTTTCCAGG + Intronic
1056453142 9:86735829-86735851 GAGAATCCCCTTCCCTTTCCAGG + Intergenic
1056481061 9:87006851-87006873 GAGCACTACTTTCACTTTCCAGG - Intergenic
1056736790 9:89216525-89216547 CAGAACTTCCTTCCTTTTCAAGG - Intergenic
1057580041 9:96279596-96279618 GAGAATCCCCTTCCCTTTCCAGG - Intronic
1058645077 9:107124243-107124265 GAGAAGTACCTTACATGTGCAGG + Intergenic
1059135542 9:111803151-111803173 GAGAAGGACCTTCCATTTGGGGG - Intergenic
1061271664 9:129547173-129547195 CAGAGCTACCTTGCCTTTCCTGG - Intergenic
1061493668 9:130959815-130959837 GAGAACTGACTTCTTTTTCCTGG - Intergenic
1186182806 X:6989412-6989434 GAGAAATTCCTTCCTTATCCTGG - Intergenic
1186530212 X:10287489-10287511 CAGAGCTACCTGCCATTTTCTGG + Intergenic
1189957111 X:46287220-46287242 GAGAATGCCCTTCCCTTTCCAGG - Intergenic
1190360333 X:49643393-49643415 GAGAATCCCCTTCCTTTTCCAGG + Intergenic
1192571249 X:72207678-72207700 GTGAAATGCCTTCCCTTTCCAGG - Exonic
1195557903 X:106248277-106248299 GAGAATCCCCTTCCCTTTCCAGG - Intergenic
1195712846 X:107788587-107788609 GAGCACTACGTTCCATTTCGAGG - Intronic
1195922751 X:109999850-109999872 GAGAATCTCCTTCCCTTTCCAGG + Intergenic
1197468165 X:126832578-126832600 GAGAATCTTCTTCCATTTCCAGG - Intergenic
1199984465 X:152940681-152940703 GAGAATCTCCTTCCCTTTCCAGG - Intronic
1201761738 Y:17547297-17547319 TAGAACAACCTTCCATTCCAGGG - Intergenic
1201839814 Y:18358693-18358715 TAGAACAACCTTCCATTCCAGGG + Intergenic