ID: 1097693370

View in Genome Browser
Species Human (GRCh38)
Location 12:62754938-62754960
Sequence TGTTATCTTTACAAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097693370 Original CRISPR TGTTATCTTTACAAGATGGG TGG Intronic
900726590 1:4220332-4220354 TGTCAACATTAGAAGATGGGAGG + Intergenic
901366504 1:8755445-8755467 TGTTGTTTATACAAGTTGGGGGG + Intronic
904148953 1:28420412-28420434 TGTCTTCTTTACAAGGTGGCAGG - Intronic
908335040 1:63113899-63113921 TGCTATCTTTACAGGATGAAGGG - Intergenic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
910274980 1:85439767-85439789 TGTTATTCTTACAAGATGCTAGG - Intronic
910403333 1:86858426-86858448 TGTGACCTCTACCAGATGGGAGG + Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911537253 1:99115218-99115240 TGTTACCTTTACTTGATTGGAGG - Intergenic
912942491 1:114057388-114057410 TGATAGCATTACAAGATGGAAGG + Intergenic
914737564 1:150432719-150432741 TGTAATCCTGACAAGTTGGGAGG + Intronic
915749700 1:158194677-158194699 TTTTATCTTTAAAAGCTAGGGGG - Intergenic
916577985 1:166084004-166084026 TGTTACCTTGTCAAGATGGAAGG - Intronic
916898976 1:169200487-169200509 TATTATCTCTAGAAGATGGCTGG - Intronic
920355013 1:205365499-205365521 TCTTATCTATATAAAATGGGGGG - Intergenic
922355096 1:224767785-224767807 TGGCATCTTAACATGATGGGAGG + Intergenic
923057288 1:230436440-230436462 TGTTATCTTGACAAAATAGAAGG + Intergenic
1063296543 10:4812436-4812458 TGTCATCTTAAGAAGATGTGAGG + Intronic
1067082707 10:43220525-43220547 TGTAATCTCAACACGATGGGAGG + Intronic
1068247072 10:54387000-54387022 TGTTGTCTGTACAAGAAGTGAGG + Intronic
1068916881 10:62442548-62442570 TGTTACCTTTAGAAGTTTGGAGG + Intronic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1073025438 10:100484007-100484029 TGGTATCCTGCCAAGATGGGAGG - Intergenic
1075415986 10:122264858-122264880 TGTTTTCTTTACAAGGAAGGTGG + Intergenic
1075427153 10:122350728-122350750 TGATTTCCTTACAAAATGGGAGG - Intergenic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1081565252 11:44256794-44256816 TATTATGTTTATCAGATGGGCGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082582299 11:54886983-54887005 TTTTATCTATACAAGATGAATGG - Intergenic
1083228618 11:61300670-61300692 TGTAATCCTTACCAGATGGAAGG - Intronic
1085449066 11:76621220-76621242 TGTTATTTTTAAAATATGGAAGG + Intergenic
1086525533 11:87721819-87721841 TGTTATTTTTGCAAGATGTTTGG + Intergenic
1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG + Intergenic
1093415014 12:18909673-18909695 TGGTATCCTTATAAGAAGGGAGG - Intergenic
1094642740 12:32291978-32292000 TGTTATCTTTGCAGGAGGGTAGG - Intronic
1095611461 12:44133446-44133468 TGAAATGTTCACAAGATGGGTGG + Intronic
1096470014 12:51869754-51869776 TGTGACCTATACAAGGTGGGAGG + Intergenic
1096759257 12:53826224-53826246 TGTTATTCTTACAAGATGTCTGG - Intergenic
1097394485 12:59057021-59057043 TGTTATATTTACAAAATTTGGGG + Intergenic
1097693370 12:62754938-62754960 TGTTATCTTTACAAGATGGGTGG + Intronic
1098260195 12:68661802-68661824 TGTTAGGGTTACAAGATGGATGG + Exonic
1098346689 12:69512526-69512548 TGGTATCTTTATAAGGTGAGTGG + Intronic
1099974082 12:89528341-89528363 TTTTAAATTTAAAAGATGGGAGG + Intergenic
1101780314 12:107829203-107829225 TGATACCTTTACAAATTGGGTGG - Intergenic
1102305755 12:111803481-111803503 TGTTATCTTAACTACTTGGGAGG + Intronic
1103121347 12:118382302-118382324 TGTAATCTCAACACGATGGGAGG - Intronic
1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG + Intergenic
1104995588 12:132652792-132652814 TGGCATCTTGACAAGATGAGAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1105846026 13:24294724-24294746 TGTAATCACTGCAAGATGGGAGG - Exonic
1106463759 13:29994828-29994850 TGTTATTTTTCCAAAATGGATGG + Intergenic
1106942261 13:34792082-34792104 TTTTATGGGTACAAGATGGGGGG - Intergenic
1107993073 13:45835408-45835430 TATTATCATTACTAGATGTGAGG - Intronic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111660282 13:91201367-91201389 TATTTTCTTTACAAGATGAAAGG - Intergenic
1111720666 13:91939956-91939978 TGTAAGCATTAAAAGATGGGAGG - Intronic
1111954807 13:94744524-94744546 TGTTATCCTTAAAGGATGTGTGG - Intergenic
1112292381 13:98156068-98156090 TTTTATTTTTAAAATATGGGAGG - Intronic
1114924144 14:27372302-27372324 TCTTATAATTACAAGAAGGGTGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1118385717 14:65254163-65254185 TGGTATCTTCACAGGCTGGGGGG + Intergenic
1120633417 14:86920612-86920634 TTTTATTTTTACTAGATGTGGGG + Intronic
1121344532 14:93125669-93125691 TGTTATTTTTAAAAGATGAATGG - Intergenic
1123416349 15:20098447-20098469 TGTTATCCTAACAATTTGGGAGG - Intergenic
1123525688 15:21105552-21105574 TGTTATCCTAACAATTTGGGAGG - Intergenic
1125433378 15:39620860-39620882 TGTAATCTTAACAATTTGGGAGG - Intronic
1128129666 15:65217708-65217730 TGCTATGGTTACAAGATGGCAGG - Intergenic
1128393638 15:67201146-67201168 TGTTTTCCTTAAAAGATGGAAGG - Exonic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1128817031 15:70617882-70617904 TATTTTCTTTGCAAGATGGAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131718324 15:95138175-95138197 TGTGATCTTTCCACGATGGTTGG + Intergenic
1133571155 16:7041637-7041659 TATTATCTTTTTAAGAAGGGTGG - Intronic
1134304835 16:13022636-13022658 TTTTATTTTTACAAGATATGGGG + Intronic
1137315161 16:47311526-47311548 TTTTATCTCTACAATATGGTAGG + Intronic
1138303672 16:55955328-55955350 TGTGATTTTTAAAAGATGGGGGG - Intronic
1139136864 16:64215326-64215348 TGTGATCTGTACAAGATTGGTGG + Intergenic
1146686314 17:34843866-34843888 TGTGGTCTTTACAGGAAGGGTGG + Intergenic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153459849 18:5321451-5321473 TGTTGTATTTAAAAGATTGGTGG + Intergenic
1153937446 18:9942389-9942411 TGTTATCTCTACAATATTTGAGG - Intronic
1154983605 18:21526455-21526477 TTTTATTTTTACCAGAAGGGTGG + Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157884100 18:51349736-51349758 TGGTGTCTTTACAAGAAGAGGGG - Intergenic
1158259586 18:55592073-55592095 TGTTATACTTAGAAGATTGGAGG + Intronic
1164046416 19:21546245-21546267 TGTTATCTTAACACTTTGGGAGG + Intronic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1168685040 19:58344070-58344092 TTTTATCTTTAAAATATGGCTGG + Intergenic
924986162 2:271849-271871 TGTTACCTTTAAAAAAAGGGAGG - Exonic
925067679 2:941179-941201 TTTTATCTTTACCAGATGGAGGG - Intergenic
925755687 2:7129734-7129756 TGGTACCTTTACGTGATGGGGGG + Intergenic
926829928 2:16950583-16950605 TCTTATCTTTACAAGTTGTTTGG - Intergenic
928444413 2:31320252-31320274 TGATATATTTACAAGATGCAGGG - Intergenic
929862227 2:45689129-45689151 TATTTGCTTTACAAGAAGGGAGG + Intronic
930579530 2:53193840-53193862 TTTAATCTTTACATGTTGGGAGG + Intergenic
931567223 2:63627543-63627565 TTTTATGGGTACAAGATGGGGGG - Intronic
931780126 2:65572297-65572319 TGGTATCTTTATAAGAAGTGGGG + Intergenic
932201719 2:69834155-69834177 TGTTATTTTGACAAGAGTGGGGG - Intronic
935611742 2:105032825-105032847 TTTTATCTTTAGATGACGGGTGG - Intergenic
936641221 2:114314661-114314683 AGTTATCTGGACAAGATGGGAGG - Intergenic
937480233 2:122250875-122250897 TGTTATCCTTACAAGAAGGAAGG + Intergenic
938995147 2:136670519-136670541 TTTTATCTTCACAGGATGTGTGG + Intergenic
941379943 2:164780061-164780083 TGTTAACTTTACTAAATGTGAGG + Intronic
945048891 2:205805341-205805363 TGTTACATTAACAAGATGGAAGG + Intergenic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
948954884 2:241281053-241281075 TATTTTCTTAATAAGATGGGGGG + Intronic
1169138580 20:3213243-3213265 TTTTATTTTTAAAAGATGGTTGG + Intronic
1171088238 20:22259235-22259257 TGTTTTCCTTTCAAGATGTGTGG + Intergenic
1173123884 20:40318936-40318958 TGCTTTCTTCACAAGATGGCAGG + Intergenic
1175208761 20:57333561-57333583 AATTATCTTTCCAAAATGGGAGG - Intronic
1180100646 21:45582500-45582522 TCTTATCTTTCCAAGTTTGGTGG - Intergenic
1181657409 22:24314758-24314780 TGTTTTGTTTTCAAAATGGGGGG - Intronic
1181999514 22:26908860-26908882 TGTGAGTTGTACAAGATGGGAGG - Intergenic
1182920965 22:34078431-34078453 TGTTTTCTTAACAAGACAGGAGG + Intergenic
1183979252 22:41530134-41530156 TGCTATCTTTAAAAAATTGGGGG - Intronic
949658421 3:6248784-6248806 TGTTATTTTTTTAAGGTGGGTGG + Intergenic
951107443 3:18761558-18761580 TGTTTTCTTGACAAAATGGAAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954761124 3:52875082-52875104 TGTTATCTATGGTAGATGGGAGG + Intronic
959410293 3:106012730-106012752 TGCAATCTTTACAACAAGGGGGG + Intergenic
963413330 3:144960924-144960946 TATTATATTTTCAAGATGGGAGG - Intergenic
965169589 3:165245255-165245277 TAACATCTTTACAAGATGAGAGG + Intergenic
965583773 3:170297086-170297108 TGTTTTAATTACATGATGGGTGG + Intronic
966711427 3:182977403-182977425 TGTTTTATTTATAAGATGGCAGG - Intronic
967267222 3:187701412-187701434 TTTTATATTTACAAAATGAGGGG - Intronic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972592917 4:40505016-40505038 TTTTATCTTTAAAAGATGCTGGG + Intronic
972886284 4:43493269-43493291 TGTTAACTTTTCAAGCAGGGAGG + Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
977036583 4:91960760-91960782 AGTTATCTTTTGAAGATGAGAGG - Intergenic
978867169 4:113527356-113527378 TGTAATCTTTGCATTATGGGAGG - Intronic
979504993 4:121485457-121485479 TGTTATCTGCACAAGAGGGTGGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
981307151 4:143258874-143258896 TCTTTTCTTTACAACATAGGAGG - Intergenic
981949022 4:150383546-150383568 AGTTATCTATACAAAATTGGGGG - Intronic
983767667 4:171505830-171505852 TGTTTTCTTTAGAAGATGAGAGG + Intergenic
987561478 5:19528628-19528650 TGTTATCTTTACAAGAATGGTGG - Intronic
989721548 5:44534813-44534835 TGTAATCTCAACAAGGTGGGAGG - Intergenic
991207415 5:64065684-64065706 TTTTATGGTTACAGGATGGGGGG - Intergenic
992411165 5:76506912-76506934 TGGTATCTTGACAACATGGAGGG - Intronic
993442081 5:87969600-87969622 TTTTATCTATATAATATGGGGGG + Intergenic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003131031 6:3395408-3395430 GCTGATCTTTACAAGATGGATGG - Intronic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1008074872 6:47134919-47134941 TGTTCGCTTTACAAGATAAGTGG + Intergenic
1008827925 6:55720877-55720899 TTTTATCATTACAAGATTTGTGG + Intergenic
1009836108 6:69003681-69003703 TGTCATGTTTACAATAAGGGCGG - Intronic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013922369 6:115422303-115422325 TGTTGTCTTTATAAGAAGAGAGG - Intergenic
1014202744 6:118623334-118623356 TGATACCTTTACAAAGTGGGTGG + Intronic
1014373834 6:120646445-120646467 TTTTTTGTTTACAAGATGGCTGG - Intergenic
1014525131 6:122493748-122493770 AATTATCTTTACATGAGGGGTGG + Intronic
1015397967 6:132756314-132756336 TTTTATTTTTTAAAGATGGGAGG - Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015461552 6:133497237-133497259 TTTTATTTTTACAAGTTGTGGGG - Intronic
1016482547 6:144497417-144497439 TGTAATCTTTGCACGTTGGGAGG + Intronic
1019966531 7:4503625-4503647 TGCTATCTTTACAAACTGGCAGG - Intergenic
1021073547 7:16273308-16273330 TTTTATGGGTACAAGATGGGAGG - Intronic
1021689641 7:23219349-23219371 TGTAATCTTTACACTTTGGGAGG + Intergenic
1023613016 7:41990688-41990710 TGAAATCTTTTGAAGATGGGAGG + Intronic
1024104887 7:46073078-46073100 TGTTGACCTTATAAGATGGGTGG - Intergenic
1024265409 7:47602525-47602547 TGGTGTCCTTACAAGGTGGGAGG - Intergenic
1027812879 7:82927901-82927923 TGTTAGCTTCAGAAAATGGGAGG + Intronic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1029152074 7:98487797-98487819 TGTTCTCATTTCAAGCTGGGTGG - Intergenic
1031380238 7:121076804-121076826 TTTTTTCTTTACAAGATCCGTGG - Intronic
1032542113 7:132711830-132711852 TGTGATCTTTACATGATTGTAGG + Intronic
1032719844 7:134542003-134542025 TGTTAACATTATAAGGTGGGCGG - Intergenic
1032987011 7:137348446-137348468 AGTTCTCTTTACAAGATTGAGGG - Intergenic
1034135874 7:148768940-148768962 TTTTATGCTCACAAGATGGGAGG + Intronic
1035425828 7:158772241-158772263 TGTGATCTTTAAAAGATCTGCGG - Intronic
1036640617 8:10581190-10581212 TGTTATTTCTACAGGATGGTTGG - Intergenic
1037595600 8:20351626-20351648 TGTTAACTCTACAAGATGATTGG + Intergenic
1040497244 8:47977089-47977111 TGTTATCTTTACTAGAGACGGGG - Exonic
1040694991 8:49985570-49985592 TTTTATCATTACAATATGAGGGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041858822 8:62487754-62487776 TGATATGTTTGCAAGATGTGTGG - Intronic
1042132484 8:65601372-65601394 TTTTATTTTTAAAAAATGGGAGG - Intergenic
1043520437 8:81039344-81039366 TGGTATATTTATAAAATGGGGGG + Intronic
1043817655 8:84822600-84822622 TGTTATCTTTGTAATATGGAAGG - Intronic
1045306251 8:100958947-100958969 TGTGATCTTAACAAGGTGTGAGG - Intergenic
1045928855 8:107600851-107600873 TGGTACCTTTACAAATTGGGTGG - Intergenic
1046292562 8:112181839-112181861 TGCTATCTTTACATGGTGGAAGG - Intergenic
1047655282 8:126970558-126970580 TGTTATCTTAACAAATAGGGAGG - Intergenic
1048180125 8:132186882-132186904 TGTTATCTTTATAAACTGTGAGG + Intronic
1052297199 9:26909978-26910000 TCTTATCTTTAAAAGATTAGTGG - Intronic
1055122950 9:72684118-72684140 TGTTTTCTTTACATTATAGGTGG + Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1056768863 9:89462515-89462537 TGTTTTCTGTACAAAATAGGTGG + Intronic
1059183012 9:112237804-112237826 TGTAGTCTTTTGAAGATGGGAGG - Intronic
1062102348 9:134734831-134734853 TGTGCTGTTTACCAGATGGGTGG + Intronic
1062166071 9:135107918-135107940 TCTTATATTTAAAACATGGGCGG + Intronic
1187480635 X:19651967-19651989 TCTTATCCTTACAAAATGAGAGG + Intronic
1189094616 X:38125066-38125088 TATTTTCTTTTCAAGATGGAAGG + Intronic
1190036358 X:47028575-47028597 TGTGATCTTTAAAAGTGGGGTGG - Intronic
1194959653 X:100220611-100220633 TATTATCTTTGCAACATGGAGGG - Intergenic
1201417105 Y:13758334-13758356 CCTTATCTTTACAAGAAGGAGGG - Intergenic